Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SDHC-succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa Gene
PTXBC033626
New product
Data sheet of SDHC-succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SDHC-succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033626 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SDHC |
| Origin species: | Human |
| Product name: | SDHC-succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa Gene |
| Size: | 2ug |
| Accessions: | BC033626 |
| Gene id: | 6391 |
| Gene description: | succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa |
| Synonyms: | CYB560; CYBL; PGL3; QPS1; SDH3; succinate dehydrogenase cytochrome b560 subunit, mitochondrial; cytochrome B large subunit of complex II; integral membrane protein CII-3b; large subunit of cytochrome b; succinate dehydrgenase cytochrome b; succinate dehydrogenase 3, integral membrane subunit; succinate dehydrogenase complex subunit C integral membrane protein 15kDa; succinate dehydrogenase complex, subunit C, integral membrane protein, 15kD; succinate-ubiquinone oxidoreductase cytochrome B large subunit; succinate dehydrogenase complex subunit C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcgctgttgctgagacacgttggtcgtcattgcctccgagcccactttagccctcagctctgtatcagaaatgctgttcctttgggaaccacggccaaagaagagatggagcggttctggaataagaatataggttcaaaccgtcctctgtctccccacattactatctacagttggtctcttcccatggcgatgtccatctgccaccgtggcactggtattgctttgagtgcaggggtctctctttttggcatgtcggccctgttactccctgggaactttgagtcttatttggaacttgtgaagtccctgtgtctggggccagcactgatccacacagctaagtttgcacttgtcttccctctcatgtatcatacctggaatgggatccgacacttgatgtgggacctaggaaaaggcctgaagattccccagctataccagtctggagtggttgtcctggttcttactgtgttgtcctctatggggctggcagccatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase) - non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) - granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) - ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) |