Login to display prices
Login to display prices
SDHC-succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa Gene View larger

SDHC-succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SDHC-succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SDHC-succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033626
Product type: DNA & cDNA
Ncbi symbol: SDHC
Origin species: Human
Product name: SDHC-succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa Gene
Size: 2ug
Accessions: BC033626
Gene id: 6391
Gene description: succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
Synonyms: CYB560; CYBL; PGL3; QPS1; SDH3; succinate dehydrogenase cytochrome b560 subunit, mitochondrial; cytochrome B large subunit of complex II; integral membrane protein CII-3b; large subunit of cytochrome b; succinate dehydrgenase cytochrome b; succinate dehydrogenase 3, integral membrane subunit; succinate dehydrogenase complex subunit C integral membrane protein 15kDa; succinate dehydrogenase complex, subunit C, integral membrane protein, 15kD; succinate-ubiquinone oxidoreductase cytochrome B large subunit; succinate dehydrogenase complex subunit C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcgctgttgctgagacacgttggtcgtcattgcctccgagcccactttagccctcagctctgtatcagaaatgctgttcctttgggaaccacggccaaagaagagatggagcggttctggaataagaatataggttcaaaccgtcctctgtctccccacattactatctacagttggtctcttcccatggcgatgtccatctgccaccgtggcactggtattgctttgagtgcaggggtctctctttttggcatgtcggccctgttactccctgggaactttgagtcttatttggaacttgtgaagtccctgtgtctggggccagcactgatccacacagctaagtttgcacttgtcttccctctcatgtatcatacctggaatgggatccgacacttgatgtgggacctaggaaaaggcctgaagattccccagctataccagtctggagtggttgtcctggttcttactgtgttgtcctctatggggctggcagccatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)
- non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)
- granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
- ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)