C3orf45-chromosome 3 open reading frame 45 Gene View larger

C3orf45-chromosome 3 open reading frame 45 Gene

PTXBC028000

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C3orf45-chromosome 3 open reading frame 45 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C3orf45-chromosome 3 open reading frame 45 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028000
Product type: DNA & cDNA
Ncbi symbol: C3orf45
Origin species: Human
Product name: C3orf45-chromosome 3 open reading frame 45 Gene
Size: 2ug
Accessions: BC028000
Gene id: 132228
Gene description: chromosome 3 open reading frame 45
Synonyms: C3orf45; leucine-rich single-pass membrane protein 2; leucine rich single-pass membrane protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccatcattggcccccgactgcccactgcttgccatgcctgaggagacccaagaagactccgtggcgccaatgatgcccagccagaggagcagggggccattggcccccaaccacgtgcatgaggtatgcctgcaccaggtggagtccatcagcgacctacatagtggagcaggcacactgcgcccctatctaactgaagaggcacgaccgtgggatgagctgctgggcgttttgccgccgtcactgtgtgcccaggctggctgcagccctgtgtacagacgaggagggttcctgctgctgctcgcgctgctggtgctcacttgcctagtgctcgcactcctggctgtctacctgagcgtgctgcagagtgaatccctgcgcatcctggcacacacgctccgcacgcaggaggagacactactcaaactccgcttggccagcctcagccagcttcggaggctcaactccagtgaggcccaagcacccagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 95
- chromosome 3 open reading frame 24
- zinc finger, C3HC-type containing 1
- superoxide dismutase 2, mitochondrial

Buy C3orf45-chromosome 3 open reading frame 45 Gene now

Add to cart