C5orf36-chromosome 5 open reading frame 36 Gene View larger

C5orf36-chromosome 5 open reading frame 36 Gene

PTXBC035515

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C5orf36-chromosome 5 open reading frame 36 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C5orf36-chromosome 5 open reading frame 36 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035515
Product type: DNA & cDNA
Ncbi symbol: C5orf36
Origin species: Human
Product name: C5orf36-chromosome 5 open reading frame 36 Gene
Size: 2ug
Accessions: BC035515
Gene id: 285600
Gene description: chromosome 5 open reading frame 36
Synonyms: C5orf36; uncharacterized protein KIAA0825
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggattgggatgatgaatattctcataattcttttgacctacattgtttgttaaactcatttcctggagacttggagtttgagcagatcttcagtgacattgatgaaaagattgaacaaaatgctgcaagcataaaacattgcattaaagagatacagtccgaaattaacaaacaatgtccaggtgtgcagctgcaaacaacaactgactgctttgaatggctaactaactataattacagtacatctgaatcatctttcatttctcatggagacttgataaaatttttcaaaacactgcaagatttgttgaagaatgaacaaaatcaagaagaaatgacattggatttactttgggacctctcctgccacagcagcgtttcattcccatcaaccctaagtggaacatctttccatttcctctctaggacgtctcttcattctgttgaagataattcctctatggatgtcaagtctatgtgggatgatataagactgcatcttcgacgcttcttagtgagcaaattacaaagccataatgaaataaacaattcacagcaaaaaattttattgaaaaagcagtgcttacaacaactcttgtttctttatccagaatcagaagttataatcaaataccaaaacatacagaataaactgttggctaatcttctgtggaactgctttccttcttacaacagagattcaaatttagatgtaatagctcatggatatcaaagtacaatgcttaagttatactcagtaataaaagaggattttaacacactatgtgaaattttagctccatcttcaatggtgaaattcattaaagaaacttacctggatactgttacagaagaaatggcaaaatttcttgaaaatttttgtgagctgcagttcagagaaaatgctgttcgtgtggttaaaacaagcaagagctccagcaagcatagaggagcagtgcatgctttgggttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 7 open reading frame 16
- chromosome 20 open reading frame 7
- chromosome 3 open reading frame 45
- chromosome 9 open reading frame 95

Buy C5orf36-chromosome 5 open reading frame 36 Gene now

Add to cart