Login to display prices
Login to display prices
C20orf7-chromosome 20 open reading frame 7 Gene View larger

C20orf7-chromosome 20 open reading frame 7 Gene

PTXBC005984

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf7-chromosome 20 open reading frame 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf7-chromosome 20 open reading frame 7 Gene

Proteogenix catalog: PTXBC005984
Ncbi symbol: C20orf7
Product name: C20orf7-chromosome 20 open reading frame 7 Gene
Size: 2ug
Accessions: BC005984
Gene id: 79133
Gene description: chromosome 20 open reading frame 7
Synonyms: C20orf7; bA526K24.2; dJ842G6.1; arginine-hydroxylase NDUFAF5, mitochondrial; NADH dehydrogenase (ubiquinone) complex I, assembly factor 5; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex assembly factor 5; NADH:ubiquinone oxidoreductase complex assembly factor 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttggaggcgacacactctatgaacttcggtgttccttacagttagcggaaacggaaagggaaggaggattttctccacacatttctcctttcactgctgtcaatgacctgggacatctgcttgggagagctggctttaatactctgactgtggacactgatgaaattcaagttaactatcctggaatgtttgaattgatggaagatttacaaggtatgggtgagagtaactgtgcttggaatagaaaagccctgctgcatcgagacacaatgctggcagctgcggcagtgtacagagaaatgtacagaaatgaagatggttcagtacctgctacataccagatctattacatgataggatggaaatatcatgagtcacaggcaagaccagctgaaagaggttccgcaactgtgtcatttggagagctaggaaaaataaacaaccttatgccaccggggaaaaaatcacaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: