C7orf16-chromosome 7 open reading frame 16 Gene View larger

C7orf16-chromosome 7 open reading frame 16 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C7orf16-chromosome 7 open reading frame 16 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C7orf16-chromosome 7 open reading frame 16 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028094
Product type: DNA & cDNA
Ncbi symbol: C7orf16
Origin species: Human
Product name: C7orf16-chromosome 7 open reading frame 16 Gene
Size: 2ug
Accessions: BC028094
Gene id: 10842
Gene description: chromosome 7 open reading frame 16
Synonyms: C7orf16; GSBS; protein phosphatase 1 regulatory subunit 17; G-substrate
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgtccactgagcaaatgcagccactggaagtctcagaagacagactggacaagctagaccctcgttgcagccacttagatgatctttcagaccagttcattaaggactgtgatctcaaaaagaagcctagaaagggaaaaaatgtacaggccaccctgaatgttgagtcagaccaaaaaaaaccaaggaggaaagatacaccggcgctgcacatcccacctttcataccaggtgtgttttcagaacatttaattaaaagatacgatgttcaagagagacatccaaagggcaaaatgatccctgttcttcataacactgacctggaacagaaaaagccaaggagaaaagacacacctgccctgcacatgtccccctttgcagcaggtgtgacattgctcagggatgagagacccaaagcaatcgtggaagatgacgaaaaggatggtgacaagatagctatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 20 open reading frame 7
- chromosome 3 open reading frame 45
- chromosome 9 open reading frame 95
- chromosome 3 open reading frame 24

Buy C7orf16-chromosome 7 open reading frame 16 Gene now

Add to cart