FAM96A-family with sequence similarity 96, member A Gene View larger

FAM96A-family with sequence similarity 96, member A Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM96A-family with sequence similarity 96, member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM96A-family with sequence similarity 96, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008865
Product type: DNA & cDNA
Ncbi symbol: FAM96A
Origin species: Human
Product name: FAM96A-family with sequence similarity 96, member A Gene
Size: 2ug
Accessions: BC008865
Gene id: 84191
Gene description: family with sequence similarity 96, member A
Synonyms: MIP18 family protein FAM96A; CIA2A; family with sequence similarity 96 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagcgggtgtccgggctgctctcctggacgctgagcagagtcctgtggctctccggcctctctgagccgggagctgcccggcagccccggatcatggaagagaaagcgctagaggtttatgatttgattagaactatccgggacccagaaaagcccaatactttagaagaactggaagtggtctcggaaagttgtgtggaagttcaggagataaatgaagaagaatatctggttattatcaggttcacgccaacagtacctcattgctctttggcgactcttattgggctgtgcttaagagtaaaacttcagcgatgtttaccatttaaacataagttggaaatctacatttctgaaggaacccactcaacagaagaagacatcaataagcagataaatgacaaagagcgagtggcagctgcaatggaaaaccccaacttacgggaaattgtggaacagtgtgtccttgaacctgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tRNA selenocysteine 1 associated protein 1
- RAS-like, estrogen-regulated, growth inhibitor
- family with sequence similarity 73, member B
- tubulointerstitial nephritis antigen-like 1

Buy FAM96A-family with sequence similarity 96, member A Gene now

Add to cart