PTXBC039879
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039879 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRNAU1AP |
| Origin species: | Human |
| Product name: | TRNAU1AP-tRNA selenocysteine 1 associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC039879 |
| Gene id: | 54952 |
| Gene description: | tRNA selenocysteine 1 associated protein 1 |
| Synonyms: | PRO1902; SECP43; TRSPAP1; tRNA selenocysteine 1-associated protein 1; tRNA selenocysteine associated protein (SECP43); tRNA selenocysteine-associated protein 1; tRNA selenocysteine 1 associated protein 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgtatgaattcttcgtcaaagtctacccctcctgtcggggaggcaaggtggttttggaccagacaggcgtgtctaagggttatggttttgtgaaattcacagatgaactggaacagaagcgagccctgacggagtgccagggagcagtgggactggggtctaagcctgtgcggctgagcgtggcaatccctaaagcgagccgtgtaaagccagtggaatatagtcagatgtacagttatagctacaaccagtattatcagcagtaccagaactactatgctcagtggggctatgaccagaacacaggcagctacagctacagttacccccagtatggctatacccagagcaccatgcagacatatgaagaagttggagatgatgcattggaagaccccatgccacagctggatgtgactgaggccaacaaggagttcatggaacagagtgaggagctgtatgacgctctgatggactgtcactggcagcccctggacacagtgtcttcagagatccctgccatgatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - RAS-like, estrogen-regulated, growth inhibitor - family with sequence similarity 73, member B - tubulointerstitial nephritis antigen-like 1 - family with sequence similarity 76, member B |