TMEM50A-transmembrane protein 50A Gene View larger

TMEM50A-transmembrane protein 50A Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM50A-transmembrane protein 50A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM50A-transmembrane protein 50A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007341
Product type: DNA & cDNA
Ncbi symbol: TMEM50A
Origin species: Human
Product name: TMEM50A-transmembrane protein 50A Gene
Size: 2ug
Accessions: BC007341
Gene id: 23585
Gene description: transmembrane protein 50A
Synonyms: IFNRC; SMP1; transmembrane protein 50A; cervical cancer oncogene 9; small membrane protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggatttctagagggcttgagatgctcagaatgcattgactggggggaaaagcgcaatactattgcttccattgctgctggtgtactattttttacaggctggtggattatcatagatgcagctgttatttatcccaccatgaaagatttcaaccactcataccatgcctgtggtgttatagcaaccatagccttcctaatgattaatgcagtatcgaatggacaagtccgaggtgatagttacagtgaaggttgtctgggtcaaacaggtgctcgcatttggcttttcgttggtttcatgttggcctttggatctctgattgcatctatgtggattctttttggaggttatgttgctaaagaaaaagacatagtataccctggaattgctgtatttttccagaatgccttcatcttttttggagggctggtttttaagtttggccgcactgaagacttatggcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 208
- transmembrane protein 87A
- COMM domain containing 10
- transmembrane protein 125

Buy TMEM50A-transmembrane protein 50A Gene now

Add to cart