Login to display prices
Login to display prices
GMFB-glia maturation factor, beta Gene View larger

GMFB-glia maturation factor, beta Gene

PTXBC005359

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GMFB-glia maturation factor, beta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GMFB-glia maturation factor, beta Gene

Proteogenix catalog: PTXBC005359
Ncbi symbol: GMFB
Product name: GMFB-glia maturation factor, beta Gene
Size: 2ug
Accessions: BC005359
Gene id: 2764
Gene description: glia maturation factor, beta
Synonyms: GMF; glia maturation factor beta; GMF-beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgagtctttggttgtttgtgatgttgccgaagatttagtggaaaagctgagaaagtttcgttttcgcaaagaaacgaacaacgctgctattataatgaagattgacaaggataaacgcctggtggtactggatgaggagcttgagggcatttcaccagatgaacttaaagatgaactacctgaacgacaacctcgcttcattgtgtatagttataaatatcaacatgatgatggaagagtttcatatcctctgtgctttattttctccagtcctgttggatgtaagcctgaacaacagatgatgtatgctggaagtaagaataagctagtccagacagctgaactaaccaaggtatttgaaataagaaataccgaagacctaactgaagaatggttacgtgagaaacttggatttttcactaatgtgaacttctgtgtttctaaagtatttatgtattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: