Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of UBE2L6-ubiquitin-conjugating enzyme E2L 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2L6-ubiquitin-conjugating enzyme E2L 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032491 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2L6 |
| Origin species: | Human |
| Product name: | UBE2L6-ubiquitin-conjugating enzyme E2L 6 Gene |
| Size: | 2ug |
| Accessions: | BC032491 |
| Gene id: | 9246 |
| Gene description: | ubiquitin-conjugating enzyme E2L 6 |
| Synonyms: | RIG-B; UBCH8; ubiquitin/ISG15-conjugating enzyme E2 L6; E2 ubiquitin-conjugating enzyme L6; retinoic acid induced gene B protein; ubiquitin carrier protein L6; ubiquitin conjugating enzyme E2L 6; ubiquitin-protein ligase L6; ubiquitin conjugating enzyme E2 L6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatggcgagcatgcgagtggtgaaggagctggaggatcttcagaagaagcctcccccatacctgcggaacctgtccagcgatgatgccaatgtcctggtgtggcacgctctcctcctacccgaccaacctccctaccacctgaaagccttcaacctgcgcatcagcttcccgccggagtatccgttcaagcctcccatgatcaaattcacaaccaagatctaccaccccaacgtggacgagaacggacagatttgcctgcccatcatcagcagtgagaactggaagccttgcaccaagacttgccaagtcctggaggccctcaatgtgctggtgaatagaccgaatatcagggagcccctgcggatggacctcgctgacctgctgacacagaatccggagctgttcagaaagaatgccgaagagttcaccctccgattcggagtggaccggccctcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAS (RAD and GEM)-like GTP binding 2 - microfibrillar associated protein 5 - organic solute transporter alpha - abhydrolase domain containing 14B |