CHRNA7-cholinergic receptor, nicotinic, alpha 7 Gene View larger

CHRNA7-cholinergic receptor, nicotinic, alpha 7 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHRNA7-cholinergic receptor, nicotinic, alpha 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHRNA7-cholinergic receptor, nicotinic, alpha 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037571
Product type: DNA & cDNA
Ncbi symbol: CHRNA7
Origin species: Human
Product name: CHRNA7-cholinergic receptor, nicotinic, alpha 7 Gene
Size: 2ug
Accessions: BC037571
Gene id: 1139
Gene description: cholinergic receptor, nicotinic, alpha 7
Synonyms: CHRNA7-2; NACHRA7; neuronal acetylcholine receptor subunit alpha-7; a7 nicotinic acetylcholine receptor; alpha 7 neuronal nicotinic acetylcholine receptor; alpha-7 nicotinic cholinergic receptor subunit; cholinergic receptor, nicotinic alpha 7; cholinergic receptor, nicotinic, alpha 7 (neuronal); cholinergic receptor, nicotinic, alpha polypeptide 7; neuronal acetylcholine receptor protein, alpha-7 chain; cholinergic receptor nicotinic alpha 7 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggaggcagatatcagtggctatatccccaatggagaatgggacctagtgggaatccccggcaagaggagtgaaaggttctatgagtgctgcaaagagccctaccccgatgtcaccttcacagtgaccatgcgccgcaggacgctctactatggcctcaacctgctgatcccctgtgtgctcatctccgccctcgccctgctggtgttcctgcttcctgcagattccggggagaagatttccctggggataacagtcttactctctcttaccgtcttcatgctgctcgtggctgagatcatgcccgcaacatccgattcggtaccattgatagcccagtacttcgccagcaccatgatcatcgtgggcctctcggtggtggtgacagtgatcgtgctgcagtaccaccaccacgaccccgacgggggcaagatgcccaagtggaccagagtcatccttctgaactggtgcgcgtggttcctgcgaatgaagaggcccggggaggacaaggtgcgcccggcctgccagcacaagcagcggcgctgcagcctggccagtgtggagatgagcgccgtggcgccgccgcccgccagcaacgggaacctgctgtacatcggcttccgcggcctggacggcgtgcactgtgtcccgacccccgactctggggtagtgtgtggccgcatggcctgctcccccacgcacgatgagcacctcctgcacggtgggcaaccccccgagggggacccggacttggccaagatcctggaggaggtccgctacattgccaaccgcttccgctgccaggacgaaagcgaggcggtctgcagcgagtggaagttcgccgcctgtgtggtggaccgcctgtgcctcatggccttctcggtcttcaccatcatctgcaccatcggcatcctgatgtcggctcccaacttcgtggaggccgtgtccaaagactttgcgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - limbic system-associated membrane protein
- Rab interacting lysosomal protein-like 2
- phospholipase A2, group IVD (cytosolic)
- nitric oxide synthase interacting protein

Buy CHRNA7-cholinergic receptor, nicotinic, alpha 7 Gene now

Add to cart