RILPL2-Rab interacting lysosomal protein-like 2 Gene View larger

RILPL2-Rab interacting lysosomal protein-like 2 Gene

PTXBC013042

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RILPL2-Rab interacting lysosomal protein-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RILPL2-Rab interacting lysosomal protein-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013042
Product type: DNA & cDNA
Ncbi symbol: RILPL2
Origin species: Human
Product name: RILPL2-Rab interacting lysosomal protein-like 2 Gene
Size: 2ug
Accessions: BC013042
Gene id: 196383
Gene description: Rab interacting lysosomal protein-like 2
Synonyms: RLP2; RILP-like protein 2; p40phox-binding protein; rab-interacting lysosomal protein-like 2; Rab interacting lysosomal protein like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagccccctgtgcgagaagaggaagaggaggagggagaggaggacgaggagagggacgaggttgggcccgagggggcgctgggcaagagccccttccagctgaccgccgaggacgtgtatgacatctcctacctgttgggccgcgagcttatggccctgggcagcgacccccgggtgacgcagctgcagttcaaagtcgtccgcgtcctggagatgctggaggcgctggtgaatgagggcagcctggcgctggaggagctgaagatggagagggaccacctcaggaaggaggtggaggggctgcggagacagagccctccggccagcggggaggtgaacctgggcccaaacaaaatggtggttgacctgacagatcccaaccgaccccgcttcactctgcaggagctaagggatgtgctgcaggaacgcaacaaactcaagtcgcagctcctggtggtgcaggaagagctgcagtgctacaagagtggcctgattccaccaagagaaggcccaggaggaagaagagaaaaagatgctgtggttactagtgccaaaaatgctggcaggaacaaggaggagaagacaatcataaaaaagctgttcttttttcgatcggggaaacagacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phospholipase A2, group IVD (cytosolic)
- nitric oxide synthase interacting protein
- non-POU domain containing, octamer-binding
- cAMP responsive element binding protein 3

Buy RILPL2-Rab interacting lysosomal protein-like 2 Gene now

Add to cart