Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PLA2G4D-phospholipase A2, group IVD (cytosolic) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLA2G4D-phospholipase A2, group IVD (cytosolic) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034571 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLA2G4D |
| Origin species: | Human |
| Product name: | PLA2G4D-phospholipase A2, group IVD (cytosolic) Gene |
| Size: | 2ug |
| Accessions: | BC034571 |
| Gene id: | 283748 |
| Gene description: | phospholipase A2, group IVD (cytosolic) |
| Synonyms: | cytosolic phospholipase A2 delta; cPLA2-delta; phospholipase A2 delta, cytosolic; phospholipase A2, group IVD (cytosolic); phospholipase A2 group IVD |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggacggctgatgaggaggatcccggagccccggatctgctttctggaagccatctggagcaacattttctccctgaacctgctggatgcctggtatgacctcaccagttctggggagtcctggaaacagcacatcaaggacaagaccaggagcttagagaaggagcccctgaccacctcggggacctcctcgcggctggaggcctcgtggctgcagccaggcacggcgctggcccaggcatttaaaggcttcctgacaggcaggcccctccaccagcgcagccccaacttcctccagggcctccagctgcaccaggactactgtagccacaaagacttctccacctgggcagactaccagcttgactccatgcccagccagctgacccccaaggagccccggctctgcctggtggacgccgcctacttcatcaacaccagctctccctccatgttccggccaggccgcaggctggacctcatcctctccttcgactactccctatctgcgcccttcgaggtaccctggtcaccccaggggaacccctctgcccagccaggccaagctccagaggcgagcagcagggccactgagcccctgccccacaccgcccgggtcccgaagggaaggagaggtgtcaggccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nitric oxide synthase interacting protein - non-POU domain containing, octamer-binding - cAMP responsive element binding protein 3 - DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 |