PLA2G4D-phospholipase A2, group IVD (cytosolic) Gene View larger

PLA2G4D-phospholipase A2, group IVD (cytosolic) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLA2G4D-phospholipase A2, group IVD (cytosolic) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PLA2G4D-phospholipase A2, group IVD (cytosolic) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034571
Product type: DNA & cDNA
Ncbi symbol: PLA2G4D
Origin species: Human
Product name: PLA2G4D-phospholipase A2, group IVD (cytosolic) Gene
Size: 2ug
Accessions: BC034571
Gene id: 283748
Gene description: phospholipase A2, group IVD (cytosolic)
Synonyms: cytosolic phospholipase A2 delta; cPLA2-delta; phospholipase A2 delta, cytosolic; phospholipase A2, group IVD (cytosolic); phospholipase A2 group IVD
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggacggctgatgaggaggatcccggagccccggatctgctttctggaagccatctggagcaacattttctccctgaacctgctggatgcctggtatgacctcaccagttctggggagtcctggaaacagcacatcaaggacaagaccaggagcttagagaaggagcccctgaccacctcggggacctcctcgcggctggaggcctcgtggctgcagccaggcacggcgctggcccaggcatttaaaggcttcctgacaggcaggcccctccaccagcgcagccccaacttcctccagggcctccagctgcaccaggactactgtagccacaaagacttctccacctgggcagactaccagcttgactccatgcccagccagctgacccccaaggagccccggctctgcctggtggacgccgcctacttcatcaacaccagctctccctccatgttccggccaggccgcaggctggacctcatcctctccttcgactactccctatctgcgcccttcgaggtaccctggtcaccccaggggaacccctctgcccagccaggccaagctccagaggcgagcagcagggccactgagcccctgccccacaccgcccgggtcccgaagggaaggagaggtgtcaggccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nitric oxide synthase interacting protein
- non-POU domain containing, octamer-binding
- cAMP responsive element binding protein 3
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 39

Buy PLA2G4D-phospholipase A2, group IVD (cytosolic) Gene now

Add to cart