Login to display prices
Login to display prices
DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene View larger

DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene

PTXBC001009

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene

Proteogenix catalog: PTXBC001009
Ncbi symbol: DDX39
Product name: DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene
Size: 2ug
Accessions: BC001009
Gene id: 10212
Gene description: DEAD (Asp-Glu-Ala-Asp) box polypeptide 39
Synonyms: DDX39; BAT1; BAT1L; DDXL; URH49; ATP-dependent RNA helicase DDX39A; DEAD (Asp-Glu-Ala-Asp) box polypeptide 39; DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A; DEAD box protein 39; DEAD-box helicase 39A; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39; UAP56-related helicase, 49 kDa; nuclear RNA helicase URH49; nuclear RNA helicase, DECD variant of DEAD box family; DExD-box helicase 39A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagaacaggatgtggaaaacgatcttttggattacgatgaagaggaagagccccaggctcctcaagagagcacaccagctccccctaagaaagacatcaagggatcctacgtttccatccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgtggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcctgggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtcttcgtgctggccaccctacagcagattgagcctgtcaacggacaggtgacggtcctggtcatgtgccacacgagggagctggccttccagatcagcaaggaatatgagcgcttttccaagtacatgcccagcgtcaaggtgtctgtgttcttcggtggtctctccatcaagaaggatgaagaagtgttgaagaagaactgtccccatgtcgtggtggggaccccgggccgcatcctggcgctcgtgcggaataggagcttcagcctaaagaatgtgaagcactttgtgctggacgagtgtgacaagatgctggagcagctggacatgcggcgggatgtgcaggagatcttccgcctgacaccacacgagaagcagtgcatgatgttcagcgccaccctgagcaaggacatccggcctgtgtgcaggaagttcatgcaggatcccatggaggtgtttgtggacgacgagaccaagctcacgctgcacggcctgcagcagtactacgtcaaactcaaagacagtgagaagaaccgcaagctctttgatctcttggatgtgctggagtttaaccaggtgataatcttcgtcaagtcagtgcagcgctgcatggccctggcccagctcctcgtggagcagaacttcccggccatcgccatccaccggggcatggcccaggaggagcgcctgtcacgctatcagcagttcaaggatttccagcggcggatcctggtggccaccaatctgtttggccgggggatggacatcgagcgagtcaacatcgtctttaactacgacatgcctgaggactcggacacctacctgcaccgggtggcccgggcgggtcgctttggcaccaaaggcctagccatcacttttgtgtctgacgagaatgatgccaaaatcctcaatgacgtccaggaccggtttgaagttaatgtggcagaacttccagaggaaatcgacatctccacatacatcgagcagagccggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: