DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene View larger

DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001009
Product type: DNA & cDNA
Ncbi symbol: DDX39
Origin species: Human
Product name: DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene
Size: 2ug
Accessions: BC001009
Gene id: 10212
Gene description: DEAD (Asp-Glu-Ala-Asp) box polypeptide 39
Synonyms: DDX39; BAT1; BAT1L; DDXL; URH49; ATP-dependent RNA helicase DDX39A; DEAD (Asp-Glu-Ala-Asp) box polypeptide 39; DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A; DEAD box protein 39; DEAD-box helicase 39A; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39; UAP56-related helicase, 49 kDa; nuclear RNA helicase URH49; nuclear RNA helicase, DECD variant of DEAD box family; DExD-box helicase 39A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagaacaggatgtggaaaacgatcttttggattacgatgaagaggaagagccccaggctcctcaagagagcacaccagctccccctaagaaagacatcaagggatcctacgtttccatccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgtggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcctgggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtcttcgtgctggccaccctacagcagattgagcctgtcaacggacaggtgacggtcctggtcatgtgccacacgagggagctggccttccagatcagcaaggaatatgagcgcttttccaagtacatgcccagcgtcaaggtgtctgtgttcttcggtggtctctccatcaagaaggatgaagaagtgttgaagaagaactgtccccatgtcgtggtggggaccccgggccgcatcctggcgctcgtgcggaataggagcttcagcctaaagaatgtgaagcactttgtgctggacgagtgtgacaagatgctggagcagctggacatgcggcgggatgtgcaggagatcttccgcctgacaccacacgagaagcagtgcatgatgttcagcgccaccctgagcaaggacatccggcctgtgtgcaggaagttcatgcaggatcccatggaggtgtttgtggacgacgagaccaagctcacgctgcacggcctgcagcagtactacgtcaaactcaaagacagtgagaagaaccgcaagctctttgatctcttggatgtgctggagtttaaccaggtgataatcttcgtcaagtcagtgcagcgctgcatggccctggcccagctcctcgtggagcagaacttcccggccatcgccatccaccggggcatggcccaggaggagcgcctgtcacgctatcagcagttcaaggatttccagcggcggatcctggtggccaccaatctgtttggccgggggatggacatcgagcgagtcaacatcgtctttaactacgacatgcctgaggactcggacacctacctgcaccgggtggcccgggcgggtcgctttggcaccaaaggcctagccatcacttttgtgtctgacgagaatgatgccaaaatcctcaatgacgtccaggaccggtttgaagttaatgtggcagaacttccagaggaaatcgacatctccacatacatcgagcagagccggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 5
- FGGY carbohydrate kinase domain containing
- ornithine aminotransferase (gyrate atrophy)
- integrin alpha FG-GAP repeat containing 2

Buy DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene now

Add to cart