NOSIP-nitric oxide synthase interacting protein Gene View larger

NOSIP-nitric oxide synthase interacting protein Gene

PTXBC009299

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NOSIP-nitric oxide synthase interacting protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NOSIP-nitric oxide synthase interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009299
Product type: DNA & cDNA
Ncbi symbol: NOSIP
Origin species: Human
Product name: NOSIP-nitric oxide synthase interacting protein Gene
Size: 2ug
Accessions: BC009299
Gene id: 51070
Gene description: nitric oxide synthase interacting protein
Synonyms: E3 ubiquitin-protein ligase NOSIP; CGI-25; nitric oxide synthase-interacting protein; eNOS-interacting protein; nitric oxide synthase interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgcggcatggcaagaactgcaccgcaggggccgtctacacctaccacgagaagaagaaggacacagcggcctcgggctatgggacccagaacattcgactgagccgggatgccgtgaaggacttcgactgctgttgtctctccctgcagccttgccacgatcctgttgtcaccccagatggctacctgtatgagcgtgaggccatcctggagtacattctgcaccagaagaaggagattgcccggcagatgaaggcctacgagaagcagcggggcacccggcgcgaggagcagaaggagcttcagcgggcggcctcgcaggaccatgtgcggggcttcctggagaaggagtcggctatcgtgagccggcccctcaaccctttcacagccaaggccctctcgggcaccagcccagatgatgtccaacctgggcccagtgtgggtcctccaagtaaggacaaggacaaagtgctgcccagcttctggatcccgtcgctgacgcccgaagccaaggccaccaagctggagaagccgtcccgcacggtgacctgccccatgtcagggaagcccctgcgcatgtcggacctgacgcccgtgcacttcacaccgctagacagctccgtggaccgcgtggggctcatcacccgcagcgagcgctacgtgtgtgccgtgacccgcgacagcctgagcaacgccaccccctgcgctgtgctgcggccctctggggctgtggtcaccctcgaatgcgtggagaagctgattcggaaggacatggtggaccctgtgactggagacaaactcacagaccgcgacatcatcgtgctgcagcggggcggtaccggcttcgcgggctccggagtgaagctgcaagcggagaaatcacggccggtgatgcaggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - non-POU domain containing, octamer-binding
- cAMP responsive element binding protein 3
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 39
- eukaryotic translation initiation factor 5

Buy NOSIP-nitric oxide synthase interacting protein Gene now

Add to cart