Login to display prices
Login to display prices
SPEM1-spermatid maturation 1 Gene View larger

SPEM1-spermatid maturation 1 Gene

PTXBC033882

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPEM1-spermatid maturation 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPEM1-spermatid maturation 1 Gene

Proteogenix catalog: PTXBC033882
Ncbi symbol: SPEM1
Product name: SPEM1-spermatid maturation 1 Gene
Size: 2ug
Accessions: BC033882
Gene id: 374768
Gene description: spermatid maturation 1
Synonyms: C17orf83; spermatid maturation protein 1; spermatid maturation 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccatggttgagcggccgaggcccgagtgggcctcgtatcacaactgcaacagcaacagctgccaggacctgggcaactctgtcctgttgctgctgggcctcatcatctgcattaacattagcatcaatatagtgaccctgctctggagccgattccgtggtgtcttataccaagtgttccatgataccatttgtgagaaagaagctcccaagtcatcattactcagaaagcagacccagccccctaagaagcagagttctcctgcagtccatcttcggtgcaccatggaccctgtgatgatgactgtgtccccgcccccagctcaccgccatcgccgtcgaggctctcccacacgctgtgctcactgcccagtagcttgggctcctgacactgatgacgagaagcctcatcagtacccagccatctgctcctaccactgggatgtccctgaggactgggaaggcttccaacacactcaggggacctgggttccctggtctcaggatgccccagagtcccctccccagaccatccgcttccagcctaccgtagaggaaaggcccctcaaaacaggcatatggtccgagctgggcctaagggcctatgtgtatcctgtgaaccccccacctcccagccctgaggctcctagccacaagaacggtggggagggggcggtgccagaggcagaggcggctcagtaccagcctgtcccagctcccaccctgggcccagcagtcatccctgaattttcccggcaccgctcctcaggccgaatagtgtatgatgcccgggacatgagacggcggcttcgggaactgacccgggaggtggaggccctgtccggctgctaccccctagcctctggatccagcactgccgaggagacaagcaagaattgggtgtaccgttccctaactgggaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: