Login to display prices
Login to display prices
CTNNBL1-catenin, beta like 1 Gene View larger

CTNNBL1-catenin, beta like 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTNNBL1-catenin, beta like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CTNNBL1-catenin, beta like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036739
Product type: DNA & cDNA
Ncbi symbol: CTNNBL1
Origin species: Human
Product name: CTNNBL1-catenin, beta like 1 Gene
Size: 2ug
Accessions: BC036739
Gene id: 56259
Gene description: catenin, beta like 1
Synonyms: C20orf33; NAP; P14L; PP8304; dJ633O20.1; beta-catenin-like protein 1; nuclear associated protein; testis development protein NYD-SP19; catenin beta like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccttttgatgccaacaaactgtattgcagtgaagtgctggccatattgctccaggacaatgatgaaaacagggaattgcttggggagctggatggaatcgatgtgcttcttcagcagttatccgtgtttaaaagacacaatcccagcacggctgaggagcaggagatgatggagaatctgtttgattccctctgctcctgtctaatgcttagttccaatcgtgagcgcttcctgaagggcgagggtcttcagctgatgaatctcatgctcagggaaaagaagatctcccggagcagtgccctgaaagtgctggaccatgccatgattggccccgaaggcacagacaactgccataagtttgttgacattcttggcttacgaaccatctttcccctctttatgaaatctcccaggaagatcaagaaagtgggaaccactgagaaggaacatgaagagcatgtctgttcgatcctggcttccctcctgcggaacctgagagggcagcagcggacccggcttctgaataaattcactgaaaatgacagtgagaaggttgacagactaatggagttgcattttaaatatctgggtgcaatgcaggtggcggacaagaagattgaaggggaaaaacacgacatggtccggcgaggagagatcatcgacaatgacaccgaggaggagttctacctccggcgcctggatgcggggctctttgttctccagcacatctgctacatcatggccgagatctgcaatgccaatgtcccccagattcgccagagggttcaccagatcctaaacatgcgaggaagctccatcaaaattgtcaggcatatcatcaaggagtatgcagagaacatcggggacggccggagcccggagttccgggagaacgagcaaaagcgcatcctgggcttgctggagaacttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UL16 binding protein 2
- biliverdin reductase A
- NFKB activating protein
- SH2B adaptor protein 1