BLVRA-biliverdin reductase A Gene View larger

BLVRA-biliverdin reductase A Gene

PTXBC008456

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BLVRA-biliverdin reductase A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BLVRA-biliverdin reductase A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008456
Product type: DNA & cDNA
Ncbi symbol: BLVRA
Origin species: Human
Product name: BLVRA-biliverdin reductase A Gene
Size: 2ug
Accessions: BC008456
Gene id: 644
Gene description: biliverdin reductase A
Synonyms: BLVR; BVR; BVRA; biliverdin reductase A; BVR A; biliverdin-IX alpha-reductase; testis tissue sperm-binding protein Li 61n
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgcagagcccgagaggaagtttggcgtggtggtggttggtgttggccgagccggctccgtgcggatgagggacttgcggaatccacacccttcctcagcgttcctgaacctgattggcttcgtgtcgagaagggagctcgggagcattgatggagtccagcagatttctttggaggatgctctttccagccaagaggtggaggtcgcctatatctgcagtgagagctccagccatgaggactacatcaggcagttccttaatgctggcaagcacgtccttgtggaataccccatgacactgtcattggcggccgctcaggaactgtgggagctggctgagcagaaaggaaaagtcttgcacgaggagcatgttgaactcttgatggaggaattcgctttcctgaaaaaagaagtggtggggaaagacctgctgaaagggtcgctcctcttcacagctggcccgttggaagaagagcggtttggcttccctgcattcagcggcatctctcgcctgacctggctggtctccctctttggggagctttctcttgtgtctgccactttggaagagcgaaaggaagatcagtatatgaaaatgacagtgtgtctggagacagagaagaaaagtccactgtcatggattgaagaaaaaggacctggtctaaaacgaaacagatatttaagcttccatttcaagtctgggtccttggagaatgtgccaaatgtaggagtgaataagaacatatttctgaaagatcaaaatatatttgtccagaaactcttgggccagttctctgagaaggaactggctgctgaaaagaaacgcatcctgcactgcctggggcttgcagaagagatccagaaatattgctgttcaaggaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NFKB activating protein
- SH2B adaptor protein 1
- ring finger protein 26
- GATA binding protein 3

Buy BLVRA-biliverdin reductase A Gene now

Add to cart