ULBP2-UL16 binding protein 2 Gene View larger

ULBP2-UL16 binding protein 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ULBP2-UL16 binding protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ULBP2-UL16 binding protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034689
Product type: DNA & cDNA
Ncbi symbol: ULBP2
Origin species: Human
Product name: ULBP2-UL16 binding protein 2 Gene
Size: 2ug
Accessions: BC034689
Gene id: 80328
Gene description: UL16 binding protein 2
Synonyms: ALCAN-alpha; N2DL2; NKG2DL2; RAET1H; NKG2D ligand 2; retinoic acid early transcript 1H; UL16 binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcagccgccgctaccaagatccttctgtgcctcccgcttctgctcctgctgtccggctggtcccgggctgggcgagccgaccctcactctctttgctatgacatcaccgtcatccctaagttcagacctggaccacggtggtgtgcggttcaaggccaggtggatgaaaagacttttcttcactatgactgtggcaacaagacagtcacacctgtcagtcccctggggaagaaactaaatgtcacaacggcctggaaagcacagaacccagtactgagagaggtggtggacatacttacagagcaactgcgtgacattcagctggagaattacacacccaaggaacccctcaccctgcaggccaggatgtcttgtgagcagaaagctgaaggacacagcagtggatcttggcagttcagtttcgatgggcagatcttcctcctctttgactcagagaagagaatgtggacaacggttcatcctggagccagaaagatgaaagaaaagtgggagaatgacaaggttgtggccatgtccttccattacttctcaatgggagactgtataggatggcttgaggacttcttgatgggcatggacagcaccctggagccaagtgcaggagcaccactcgccatgtcctcaggcacaacccaactcagggccacagccaccaccctcatcctttgctgcctcctcatcatcctcccctgcttcatcctccctggcatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - biliverdin reductase A
- NFKB activating protein
- SH2B adaptor protein 1
- ring finger protein 26

Buy ULBP2-UL16 binding protein 2 Gene now

Add to cart