Login to display prices
Login to display prices
HIST1H2AM-histone cluster 1, H2am Gene View larger

HIST1H2AM-histone cluster 1, H2am Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST1H2AM-histone cluster 1, H2am Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HIST1H2AM-histone cluster 1, H2am Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032756
Product type: DNA & cDNA
Ncbi symbol: HIST1H2AM
Origin species: Human
Product name: HIST1H2AM-histone cluster 1, H2am Gene
Size: 2ug
Accessions: BC032756
Gene id: 8336
Gene description: histone cluster 1, H2am
Synonyms: H2A.1; H2A/n; H2AFN; dJ193B12.1; histone H2A type 1; H2A histone family, member N; histone 1, H2am; histone cluster 1, H2am; histone cluster 1 H2A family member m
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggacgtggcaagcagggcggcaaggctcgcgccaaggccaaaacccgctcctctagagctgggctccaatttcctgtaggacgagtgcaccgcctgctccgcaagggcaactacgctgagcgggtcggggccggcgcgccggtttacctggcggcggtgctggagtacctaactgccgagatcctggagctggcgggcaacgcagcccgcgacaacaaaaagacccgcatcatcccgcgccacttgcagctggccatccgcaacgacgaggagctcaacaagctgcttggtaaagttaccatcgctcagggcggtgttctgcctaacatccaggccgtactgctccccaagaagactgagagccaccacaaagctaagggcaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Norrie disease (pseudoglioma)
- glia maturation factor, beta
- transmembrane protein 50A
- transmembrane protein 208