AZGP1-alpha-2-glycoprotein 1, zinc-binding Gene View larger

AZGP1-alpha-2-glycoprotein 1, zinc-binding Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AZGP1-alpha-2-glycoprotein 1, zinc-binding Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AZGP1-alpha-2-glycoprotein 1, zinc-binding Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033830
Product type: DNA & cDNA
Ncbi symbol: AZGP1
Origin species: Human
Product name: AZGP1-alpha-2-glycoprotein 1, zinc-binding Gene
Size: 2ug
Accessions: BC033830
Gene id: 563
Gene description: alpha-2-glycoprotein 1, zinc-binding
Synonyms: ZA2G; ZAG; zinc-alpha-2-glycoprotein; Alpha-2-glycoprotein, zinc; Zn-alpha2-glycoprotein; testicular tissue protein Li 227; zn-alpha-2-GP; zn-alpha-2-glycoprotein; alpha-2-glycoprotein 1, zinc-binding
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtaagaatggtgcctgtcctgctgtctctgctgctgcttctgggtcctgctgtcccccaggagaaccaagatggtcgttactctctgacctatatctacactgggctgtccaagcatgttgaagacgtccccgcgtttcaggcccttggctcactcaatgacctccagttctttagatacaacagtaaagacaggaagtctcagcccatgggactctggagacaggtggaaggaatggaggattggaagcaggacagccaacttcagaaggccagggaggacatctttatggagaccctgaaagacattgtggagtattacaacgacagtaacgggtctcacgtattgcagggaaggtttggttgtgagatcgagaataacagaagcagcggagcattctggaaatattactatgatggaaaggactacattgaattcaacaaagaaatcccagcctgggtccccttcgacccagcagcccagataaccaagcagaagtgggaggcagaaccagtctacgtgcagcgggccaaggcttacctggaggaggagtgccctgcgactctgcggaaatacctgaaatacagcaaaaatatcctggaccggcaagatcctccctctgtggtggtcaccagccaccaggccccaggagaaaagaagaaactgaagtgcctggcctacgacttctacccagggaaaattgatgtgcactggactcgggccggcgaggtgcaggagcctgagttacggggagatgttcttcacaatggaaatggcacttaccagtcctgggtggtggtggcagtgcccccgcaggacacagccccctactcctgccacgtgcagcacagcagcctggcccagcccctcgtggtgccctgggaggccagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 2 open reading frame 58
- chromosome 5 open reading frame 36
- chromosome 7 open reading frame 16
- chromosome 20 open reading frame 7

Buy AZGP1-alpha-2-glycoprotein 1, zinc-binding Gene now

Add to cart