Login to display prices
Login to display prices
AZGP1-alpha-2-glycoprotein 1, zinc-binding Gene View larger

AZGP1-alpha-2-glycoprotein 1, zinc-binding Gene

PTXBC033830

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AZGP1-alpha-2-glycoprotein 1, zinc-binding Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AZGP1-alpha-2-glycoprotein 1, zinc-binding Gene

Proteogenix catalog: PTXBC033830
Ncbi symbol: AZGP1
Product name: AZGP1-alpha-2-glycoprotein 1, zinc-binding Gene
Size: 2ug
Accessions: BC033830
Gene id: 563
Gene description: alpha-2-glycoprotein 1, zinc-binding
Synonyms: ZA2G; ZAG; zinc-alpha-2-glycoprotein; Alpha-2-glycoprotein, zinc; Zn-alpha2-glycoprotein; testicular tissue protein Li 227; zn-alpha-2-GP; zn-alpha-2-glycoprotein; alpha-2-glycoprotein 1, zinc-binding
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtaagaatggtgcctgtcctgctgtctctgctgctgcttctgggtcctgctgtcccccaggagaaccaagatggtcgttactctctgacctatatctacactgggctgtccaagcatgttgaagacgtccccgcgtttcaggcccttggctcactcaatgacctccagttctttagatacaacagtaaagacaggaagtctcagcccatgggactctggagacaggtggaaggaatggaggattggaagcaggacagccaacttcagaaggccagggaggacatctttatggagaccctgaaagacattgtggagtattacaacgacagtaacgggtctcacgtattgcagggaaggtttggttgtgagatcgagaataacagaagcagcggagcattctggaaatattactatgatggaaaggactacattgaattcaacaaagaaatcccagcctgggtccccttcgacccagcagcccagataaccaagcagaagtgggaggcagaaccagtctacgtgcagcgggccaaggcttacctggaggaggagtgccctgcgactctgcggaaatacctgaaatacagcaaaaatatcctggaccggcaagatcctccctctgtggtggtcaccagccaccaggccccaggagaaaagaagaaactgaagtgcctggcctacgacttctacccagggaaaattgatgtgcactggactcgggccggcgaggtgcaggagcctgagttacggggagatgttcttcacaatggaaatggcacttaccagtcctgggtggtggtggcagtgcccccgcaggacacagccccctactcctgccacgtgcagcacagcagcctggcccagcccctcgtggtgccctgggaggccagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: