FABP1-fatty acid binding protein 1, liver Gene View larger

FABP1-fatty acid binding protein 1, liver Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FABP1-fatty acid binding protein 1, liver Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FABP1-fatty acid binding protein 1, liver Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032801
Product type: DNA & cDNA
Ncbi symbol: FABP1
Origin species: Human
Product name: FABP1-fatty acid binding protein 1, liver Gene
Size: 2ug
Accessions: BC032801
Gene id: 2168
Gene description: fatty acid binding protein 1, liver
Synonyms: FABPL; L-FABP; fatty acid-binding protein, liver; fatty acid binding protein 1, liver; liver-type fatty acid-binding protein; fatty acid binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtttctccggcaagtaccaactgcagagccaggaaaactttgaagccttcatgaaggcaatcggtctgccggaagagctcatccagaaggggaaggatatcaagggggtgtcggaaatcgtgcagaatgggaagcacttcaagttcaccatcaccgctgggtccaaagtgatccaaaacgaattcacggtgggggaggaatgtgagctggagacaatgacaggggagaaagtcaagacagtggttcagttggaaggtgacaataaactggtgacaactttcaaaaacatcaagtctgtgaccgaactcaacggcgacataatcaccaataccatgacattgggtgacattgtcttcaagagaatcagcaagagaatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-conjugating enzyme E2L 6
- RAS (RAD and GEM)-like GTP binding 2
- microfibrillar associated protein 5
- organic solute transporter alpha

Buy FABP1-fatty acid binding protein 1, liver Gene now

Add to cart