Login to display prices
Login to display prices
GAGE12I-G antigen 12I Gene View larger

GAGE12I-G antigen 12I Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GAGE12I-G antigen 12I Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GAGE12I-G antigen 12I Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031628
Product type: DNA & cDNA
Ncbi symbol: GAGE12I
Origin species: Human
Product name: GAGE12I-G antigen 12I Gene
Size: 2ug
Accessions: BC031628
Gene id: 26748
Gene description: G antigen 12I
Synonyms: AL4; CT4.7; GAGE-7B; GAGE7B; G antigen 12I; G antigen 7B; cancer/testis antigen 4.7; g antigen 12F/G/I
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagttggcgaggaagatcgacctattattggcctagaccaaggcgctatgtacagcctcctgaaatgattgggcctatgcggcccgagcagttcagtgatgaagtggaaccagcaacacctgaagaaggggaaccagcaactcaacgtcaggatcctgcagctgctcaggagggagaggatgagggagcatctgcaggtcaagggccgaagcctgaagctcatagccaggaacagggtcacccacagactgggtgtgagtgtgaagatggtcctgatgggcaggagatggacccgccaaatccagaggaggtgaaaacgcctgaagaaggtgaaaagcaatcacagtgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cystatin 9-like
- riboflavin kinase
- peroxiredoxin 1
- forkhead box A3