CST9L-cystatin 9-like Gene View larger

CST9L-cystatin 9-like Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CST9L-cystatin 9-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CST9L-cystatin 9-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029656
Product type: DNA & cDNA
Ncbi symbol: CST9L
Origin species: Human
Product name: CST9L-cystatin 9-like Gene
Size: 2ug
Accessions: BC029656
Gene id: 128821
Gene description: cystatin 9-like
Synonyms: CTES7B; bA218C14.1; cystatin-9-like; testatin; testicular tissue protein Li 45; cystatin 9-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgggcctgccgtggaagggaggtctgtcctgggcgctgctgctgcttctcttaggctcccagatcctgctgatctatgcctggcatttccacgagcaaagggactgtgatgaacacaatgtcatggctcgttacctccctgccacagtggagtttgctgtccacacattcaaccaacagagcaaggactactatgcctacagactggggcacatcttgaattcctggaaggagcaggtggagtccaagactgtattctcaatggagctactgctggggagaactaggtgtgggaaatttgaagacgacattgacaactgccatttccaagaaagcacagagctgaacaatactttcacctgcttcttcaccatcagcaccaggccctggatgactcagttcagcctcctgaacaagacctgcttggagggattccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - riboflavin kinase
- peroxiredoxin 1
- forkhead box A3
- spermine synthase

Buy CST9L-cystatin 9-like Gene now

Add to cart