Login to display prices
Login to display prices
FOXA3-forkhead box A3 Gene View larger

FOXA3-forkhead box A3 Gene

PTXBC016024

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FOXA3-forkhead box A3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FOXA3-forkhead box A3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016024
Product type: DNA & cDNA
Ncbi symbol: FOXA3
Origin species: Human
Product name: FOXA3-forkhead box A3 Gene
Size: 2ug
Accessions: BC016024
Gene id: 3171
Gene description: forkhead box A3
Synonyms: FKHH3; HNF3G; TCF3G; hepatocyte nuclear factor 3-gamma; HNF-3-gamma; HNF-3G; TCF-3G; fork head-related protein FKH H3; forkhead box protein A3; transcription factor 3G; forkhead box A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgggctcagtgaagatggaggcccatgacctggccgagtggagctactacccggaggcgggcgaggtctactcgccggtgaccccagtgcccaccatggcccccctcaactcctacatgaccctgaatcctctaagctctccctatccccctggggggctccctgcctccccactgccctcaggacccctggcacccccagcacctgcagcccccctggggcccactttcccaggcctgggtgtcagcggtggcagcagcagctccgggtacggggccccgggtcctgggctggtgcacgggaaggagatgccgaaggggtatcggcggcccctggcacacgccaagccaccgtattcctatatctcactcatcaccatggccatccagcaggcgccgggcaagatgctgaccttgagtgaaatctaccagtggatcatggacctcttcccttactaccgggagaatcagcagcgctggcagaactccattcgccactcgctgtctttcaacgactgcttcgtcaaggtggcgcgttccccagacaagcctggcaagggctcctactgggccctacaccccagctcagggaacatgtttgagaatggctgctacctgcgccgccagaaacgcttcaagctggaggagaaggtgaaaaaagggggcagcggggctgccaccaccaccaggaacgggacagggtctgctgcctcgaccaccacccccgcggccacagtcacctccccgccccagcccccgcctccagcccctgagcctgaggcccagggcggggaagatgtgggggctctggactgtggctcacccgcttcctccacaccctatttcactggcctggagctcccaggggagctgaagctggacgcgccctacaacttcaaccaccctttctccatcaacaacctaatgtcagaacagacaccagcacctcccaaactggacgtggggtttgggggctacggggctgaaggtggggagcctggagtctactaccagggcctctattcccgctctttgcttaatgcatcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spermine synthase
- mevalonate kinase
- inhibin, beta A
- sequestosome 1