Login to display prices
Login to display prices
SQSTM1-sequestosome 1 Gene View larger

SQSTM1-sequestosome 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SQSTM1-sequestosome 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SQSTM1-sequestosome 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003139
Product type: DNA & cDNA
Ncbi symbol: SQSTM1
Origin species: Human
Product name: SQSTM1-sequestosome 1 Gene
Size: 2ug
Accessions: BC003139
Gene id: 8878
Gene description: sequestosome 1
Synonyms: A170; DMRV; FTDALS3; NADGP; OSIL; PDB3; ZIP3; p60; p62; p62B; sequestosome-1; EBI3-associated protein of 60 kDa; EBI3-associated protein p60; EBIAP; oxidative stress induced like; phosphotyrosine independent ligand for the Lck SH2 domain p62; phosphotyrosine-independent ligand for the Lck SH2 domain of 62 kDa; ubiquitin-binding protein p62; sequestosome 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtcgctcaccgtgaaggcctaccttctgggcaaggaggacgcggcgcgcgagattcgccgcttcagcttctgctgcagccccgagcctgaggcggaagccgaggctgcggcgggtccgggaccctgcgagcggctgctgagccgggtggccgccctgttccccgcgctgcggcctggcggcttccaggcgcactaccgcgatgaggacggggacttggttgccttttccagtgacgaggaattgacaatggccatgtcctacgtgaaggatgacatcttccgaatctacattaaagagaaaaaagagtgccggcgggaccaccgcccaccgtgtgctcaggaggcgccccgcaacatggtgcaccccaatgtgatctgcgatggctgcaatgggcctgtggtaggaacccgctacaagtgcagcgtctgcccagactacgacttgtgtagcgtctgcgagggaaagggcttgcaccgggggcacaccaagctcgcattccccagccccttcgggcacctgtctgagggcttctcgcacagccgctggctccggaaggtgaaacacggacacttcgggtggccaggatgggaaatgggtccaccaggaaactggagcccacgtcctcctcgtgcaggggaggcccgccctggccccacggcagaatcagcttctggtccatcggaggatccgagtgtgaatttcctgaagaacgttggggagagtgtggcagctgcccttagccctctgggcattgaagttgatatcgatgtggagcacggagggaaaagaagccgcctgacccccgtctctccagagagttccagcacagaggagaagagcagctcacagccaagcagctgctgctctgatcccagcaagccgggtgggaatgttgagggcgccacgcagtctctggcggagcagatgagaaagatcgccttggagtccgaggggcgccctgaggaacagatggagtcggataactgttcaggaggagatgatgactggacccatctgtcttcaaaagaagtggacccgtctacaggtgaactccagtccctacagatgccagaatccgaagggccaagctctctggacccctcccaggagggacccacagggctgaaggaagctgccttgtacccacatctcccgccagaggctgacccgcggctgattgagtccctctcccagatgctgtccatgggcttctctgatgaaggcggctggctcaccaggctcctgcagaccaagaactatgacatcggagcggctctggacaccatccagtattcaaagcatcccccgccgttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tubulin, beta 4
- F-box protein 5
- ubiquilin-like
- splicing factor 1