TUBB4-tubulin, beta 4 Gene View larger

TUBB4-tubulin, beta 4 Gene

PTXBC006570

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TUBB4-tubulin, beta 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TUBB4-tubulin, beta 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006570
Product type: DNA & cDNA
Ncbi symbol: TUBB4
Origin species: Human
Product name: TUBB4-tubulin, beta 4 Gene
Size: 2ug
Accessions: BC006570
Gene id: 10382
Gene description: tubulin, beta 4
Synonyms: TUBB4; DYT4; beta-5; tubulin beta-4A chain; dystonia 4, torsion (autosomal dominant); tubulin beta-4 chain; tubulin, beta 4; tubulin, beta, 5; tubulin beta 4A class Iva
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgggagatcgtgcacctgcaggccggccagtgcggcaaccagatcggggccaagttttgggaggttatcagtgacgaacatggcatcgaccccacaggcacataccatggggacagtgacctgcaactggagaggatcaacgtgtactacaacgaggccacaggaggaaattatgtccccagagcggtgctggtggacctggaacccggcaccatggactctgtccgttctggccccttcggtcagatctttcggccggacaacttcgtgtttggccaatccggagccggcaacaactgggcaaaggggcactacacggagggcgcagagctggtggacgctgtcctggacgtagtccggaaggaggccgagagctgcgactgccttcagggcttccagctgacccactcgctggggggtggcacggggtccggaatgggcacgctgctcatcagtaagatccgcgaggagttcccagaccgcatcatgaacaccttcagcgtggtgccctcgcccaaagtgtcagacacggtggtggagccctacaacgccacgctgtctgtgcaccagctggtggagaatacggatgagacctactgcatcgacaacgaggcactctacgacatctgtttccgcaccctcaagctgaccacccccacctacggggacctcaaccacctggtgtcggccaccatgagcggggtcaccacctgcctgcgcttcccgggccagctgaacgccgacctgcgcaagctggccgtcaacatggtcccctttcctcgcctgcacttcttcatgcccggcttcgcacccctgaccagccggggcagccagcagtaccgggccctgacggtgcccgagctcacccagcagatgttcgatgccaagaacatgatggcggcgtgcgacccgcgccacggccgctacctgaccgtggccgccgtgttccggggccgcatgtccatgaaggaggtggacgagcagatgctgagcgtgcagagcaagaacagcagctacttcgtggagtggatccccaacaacgtgaagacggccgtgtgcgacatcccgccccgcggcctgaagatggccgcgaccttcatcggcaacagcacggccatccaggagctgttcaagcgcatctccgagcagttcacggccatgttccggcgcaaggccttcttgcactggtacacgggcgagggcatggacgagatggagttcaccgaggccgagagcaacatgaatgacctggtatctgagtaccagcagtaccaggacgccacggccgaggagggcgagttcgaggaggaggcggaggaggaggtggcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - F-box protein 5
- ubiquilin-like
- splicing factor 1
- alpha-fetoprotein

Buy TUBB4-tubulin, beta 4 Gene now

Add to cart