UBQLNL-ubiquilin-like Gene View larger

UBQLNL-ubiquilin-like Gene

PTXBC012183

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBQLNL-ubiquilin-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBQLNL-ubiquilin-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012183
Product type: DNA & cDNA
Ncbi symbol: UBQLNL
Origin species: Human
Product name: UBQLNL-ubiquilin-like Gene
Size: 2ug
Accessions: BC012183
Gene id: 143630
Gene description: ubiquilin-like
Synonyms: ubiquilin-like protein; ubiquilin-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccagagtggatgtccatcaggtctgctggcagacaaaaatatctcttcaagtgccactcgagtgatagtgaagactgcaggcaaccagaaagactttatggtagctgatgacatctcggtaaggcagttcaaggagatgctattggctcacttccaatgccagatggaccaactagtgctggtcttcatgggttgccttctcaaagaccatgacacactgagccagaggggcatcatggatggccacaccatctacttggtcatcaagtccaagcagggctccagatctctagcccattccttccgggacctgccaacgaatgatccctgccaccgggacagaaacaccaaaggaaacagcagcagagtgcaccaaccaactggtatgaatcaagctccagtggaactggcccactttgtggggtctgatgcacccaaagtgcatacccaaaacttggaagtgagccacccagagtgcaaagcacagatgctggagaatcctagcatccagcggcttctgtccaacatggagttcatgtggcagttcatttcagaacatctagacacgcaacaattgatgcagcagaacccagaagtttcccgccttcttcttgataattctgagatcctattgcagactctggagctggccaggaaccttgctatgatccaagagataatgcagatccaacaaccttcacaaaaccttgagtatccactgaacccacagccatatctgggcttagagacaatgccaggtgggaataatgccctgggtcagaactatgttgatatcaatgatcaaatgctgaacagcatgcaagatccttttggaggaaaccctttcacagctctcctggcaggacaagtgctagaacaagtccagtcttcacccccacctccaccaccatcacaggaacaacaagaccagctcacacagcatcctgcaacccgagtcatctataatagctctggtggtttctcttcaaacacctcagccaatgacacccttaacaaggtcaaccacacttccaaagccaacactgctatgatttccaccaagggccagagccatatctgtgccactcggcagccagctgggataccagccttacctagcatagagcttacccagcagcttcaagaagaatacaaggatgccactgtttctctaagtagctccagacagacattaaagggtgatctccagctgtcagatgagcagagcagctcccagatcacaggaggcatgatgcagttgcttatgaacaacccctacctggcagctcagattatgttgttcacaagtatgccccagctgagtgaagagtggaggcagcagctgcccacattcctgcagcagacacagatttctgatctgcttagtgcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - splicing factor 1
- alpha-fetoprotein
- forkhead box M1
- ubiquitin-like 5

Buy UBQLNL-ubiquilin-like Gene now

Add to cart