Login to display prices
Login to display prices
UBL5-ubiquitin-like 5 Gene View larger

UBL5-ubiquitin-like 5 Gene

PTXBC007053

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBL5-ubiquitin-like 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBL5-ubiquitin-like 5 Gene

Proteogenix catalog: PTXBC007053
Ncbi symbol: UBL5
Product name: UBL5-ubiquitin-like 5 Gene
Size: 2ug
Accessions: BC007053
Gene id: 59286
Gene description: ubiquitin-like 5
Synonyms: HUB1; ubiquitin-like protein 5; beacon; testicular tissue protein Li 217; ubiquitin like 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcgaggttgtttgcaacgaccgtctggggaagaaggtccgcgttaaatgcaacacggatgataccatcggggaccttaagaagctgattgcagcccaaactggtacccgttggaacaagattgtcctgaagaagtggtacacgatttttaaggaccacgtgtctctgggggactatgaaatccacgatgggatgaacctggagctttattatcaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: