Login to display prices
Login to display prices
SYNGR1-synaptogyrin 1 Gene View larger

SYNGR1-synaptogyrin 1 Gene

PTXBC000731

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SYNGR1-synaptogyrin 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SYNGR1-synaptogyrin 1 Gene

Proteogenix catalog: PTXBC000731
Ncbi symbol: SYNGR1
Product name: SYNGR1-synaptogyrin 1 Gene
Size: 2ug
Accessions: BC000731
Gene id: 9145
Gene description: synaptogyrin 1
Synonyms: synaptogyrin-1; synaptogyrin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagggggtgcgtacggagcgggcaaagccgggggcgccttcgacccctacaccctggtccggcagccgcacaccatcctgcgcgtcgtgtcttggctgttctccatagtggtgttcggctccatcgtgaacgagggctacctcaacagcgcctccgagggggaggagttctgcatctacaaccgcaaccccaacgcctgcagctatggcgtggccgtgggcgtgctcgccttcctcacctgcctgctgtacctggccctggacgtgtacttcccgcagatcagcagcgtcaaggaccgcaagaaagccgtcctgtccgacatcggtgtctcggccttctgggctttcctctggttcgtgggattctgctacctggccaaccagtggcaggtctccaagcccaaggacaacccactgaacgaagggacggacgcagcccgggccgccatcgccttctcctttttctccatcttcacctggagcctgaccgcagccctggccgtgcggagattcaaggacctaagcttccaggaggagtacagcacactgttccctgcctcggcacagccgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: