Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PRDX4-peroxiredoxin 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRDX4-peroxiredoxin 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003609 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRDX4 |
| Origin species: | Human |
| Product name: | PRDX4-peroxiredoxin 4 Gene |
| Size: | 2ug |
| Accessions: | BC003609 |
| Gene id: | 10549 |
| Gene description: | peroxiredoxin 4 |
| Synonyms: | AOE37-2; AOE372; HEL-S-97n; PRX-4; peroxiredoxin-4; antioxidant enzyme AOE372; epididymis secretory sperm binding protein Li 97n; peroxiredoxin IV; prx-IV; thioredoxin peroxidase (antioxidant enzyme); thioredoxin peroxidase AO372; thioredoxin-dependent peroxide reductase A0372; peroxiredoxin 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggcgctgccgctgctagccgcgacaactccggaccacggccgccaccgaaggctgcttctgctgccgctactgctgttcctgctgccggctggagctgtgcagggctgggagacagaggagaggccccggactcgcgaagaggagtgccacttctacgcgggtggacaagtgtacccgggagaggcatcccgggtatcggtcgccgaccactccctgcacctaagcaaagcgaagatttccaagccagcgccctactgggaaggaacagctgtgatcgatggagaatttaaggagctgaagttaactgattatcgtgggaaatacttggttttcttcttctacccacttgatttcacatttgtgtgtccaactgaaattatcgcttttggcgacagacttgaagaattcagatctataaatactgaagtggtagcatgctctgttgattcacagtttacccatttggcctggattaatacccctcgaagacaaggaggacttgggccaataaggattccacttctttcagatttgacccatcagatctcaaaggactatggtgtatacctagaggactcaggccacactcttagaggtctcttcattattgatgacaaaggaatcctaagacaaattactctgaatgatcttcctgtgggtagatcagtggatgagacactacgtttggttcaagcattccagtacactgacaaacacggagaagtctgccctgctggctggaaacctggtagtgaaacaataatcccagatccagctggaaagctgaagtatttcgataaactgaattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proline rich 14 - forkhead box M1 - lysozyme-like 1 - stathmin-like 4 |