Login to display prices
Login to display prices
PRDX4-peroxiredoxin 4 Gene View larger

PRDX4-peroxiredoxin 4 Gene

PTXBC003609

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRDX4-peroxiredoxin 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRDX4-peroxiredoxin 4 Gene

Proteogenix catalog: PTXBC003609
Ncbi symbol: PRDX4
Product name: PRDX4-peroxiredoxin 4 Gene
Size: 2ug
Accessions: BC003609
Gene id: 10549
Gene description: peroxiredoxin 4
Synonyms: AOE37-2; AOE372; HEL-S-97n; PRX-4; peroxiredoxin-4; antioxidant enzyme AOE372; epididymis secretory sperm binding protein Li 97n; peroxiredoxin IV; prx-IV; thioredoxin peroxidase (antioxidant enzyme); thioredoxin peroxidase AO372; thioredoxin-dependent peroxide reductase A0372; peroxiredoxin 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcgctgccgctgctagccgcgacaactccggaccacggccgccaccgaaggctgcttctgctgccgctactgctgttcctgctgccggctggagctgtgcagggctgggagacagaggagaggccccggactcgcgaagaggagtgccacttctacgcgggtggacaagtgtacccgggagaggcatcccgggtatcggtcgccgaccactccctgcacctaagcaaagcgaagatttccaagccagcgccctactgggaaggaacagctgtgatcgatggagaatttaaggagctgaagttaactgattatcgtgggaaatacttggttttcttcttctacccacttgatttcacatttgtgtgtccaactgaaattatcgcttttggcgacagacttgaagaattcagatctataaatactgaagtggtagcatgctctgttgattcacagtttacccatttggcctggattaatacccctcgaagacaaggaggacttgggccaataaggattccacttctttcagatttgacccatcagatctcaaaggactatggtgtatacctagaggactcaggccacactcttagaggtctcttcattattgatgacaaaggaatcctaagacaaattactctgaatgatcttcctgtgggtagatcagtggatgagacactacgtttggttcaagcattccagtacactgacaaacacggagaagtctgccctgctggctggaaacctggtagtgaaacaataatcccagatccagctggaaagctgaagtatttcgataaactgaattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: