LYZL1-lysozyme-like 1 Gene View larger

LYZL1-lysozyme-like 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LYZL1-lysozyme-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LYZL1-lysozyme-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021730
Product type: DNA & cDNA
Ncbi symbol: LYZL1
Origin species: Human
Product name: LYZL1-lysozyme-like 1 Gene
Size: 2ug
Accessions: BC021730
Gene id: 84569
Gene description: lysozyme-like 1
Synonyms: KAAG648; LYC2; LYZD1; PRO1278; bA534G20.1; lysozyme-like protein 1; lysozyme D1; lysozyme like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggacgctcccctgagctgcctgtcaccgactaggtggagcagtgtttcttccgcagactcaactgagaagtcagcctctggggcaggcaccaggaatctgccttttcagttctgtctccggcaggctttgaggatgaaggctgcgggcattctgaccctcattggctgcctggtcacaggcgccgagtccaaaatctacactcgttgcaaactggcaaaaatattctcgagggctggcctggacaattactggggcttcagccttggaaactggatctgcatggcatattatgagagcggctacaacaccacagccccgacggtcctggatgacggcagcatcgactatggcatcttccagatcaacagcttcgcgtggtgcagacgcggaaagctgaaggagaacaaccactgccatgtcgcctgctcagccttgatcactgatgacctcacagatgcaattatctgtgccaggaaaattgttaaagagacacaaggaatgaactattggcaaggctggaagaaacattgtgagggcagagacctgtccgagtggaaaaaaggctgtgaggtttcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - stathmin-like 4
- peroxiredoxin 3
- forkhead box S1
- sequestosome 1

Buy LYZL1-lysozyme-like 1 Gene now

Add to cart