PRDX3-peroxiredoxin 3 Gene View larger

PRDX3-peroxiredoxin 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRDX3-peroxiredoxin 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRDX3-peroxiredoxin 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021691
Product type: DNA & cDNA
Ncbi symbol: PRDX3
Origin species: Human
Product name: PRDX3-peroxiredoxin 3 Gene
Size: 2ug
Accessions: BC021691
Gene id: 10935
Gene description: peroxiredoxin 3
Synonyms: AOP-1; AOP1; HBC189; MER5; PRO1748; SP-22; prx-III; thioredoxin-dependent peroxide reductase, mitochondrial; antioxidant protein 1; peroxiredoxin III; protein MER5 homolog; peroxiredoxin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctgctgtaggacggttgctccgagcgtcggttgcccgacatgtgagtgccattccttggggcatttctgccactgcagccctcaggcctgctgcatgtggaagaacgagcttgacaaatttattgtgttctggttccagtcaagcaaaattattcagcaccagttcctcatgccatgcacctgctgtcacccagcatgcaccctattttaagggtacagccgttgtcaatggagagttcaaagacctaagccttgatgactttaaggggaaatatttggtgcttttcttctatcctttggatttcacctttgtgtgtcctacagaaattgttgcttttagtgacaaagctaacgaatttcacgatgtgaactgtgaagttgtcgcagtctcagtggattcccactttagccatcttgcctggataaatacaccaaggaagaatggtggtttgggccacatgaacatcgcactcttgtcagacttaactaagcagatttcccgagactacggtgtgctgttagaaggttctggtcttgcactaagaggtctcttcataattgaccccaatggagtcatcaagcatttgagcgtcaacgatctcccagtgggccgaagcgtggaagaaaccctccgcttggtgaaggcgttccagtatgtagaaacacatggagaagtctgcccagcgaactggacaccggattctcctacgatcaagccaagtccagctgcttccaaagagtactttcagaaggtaaatcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - forkhead box S1
- sequestosome 1
- galactokinase 1
- synaptotagmin IV

Buy PRDX3-peroxiredoxin 3 Gene now

Add to cart