Login to display prices
Login to display prices
PRDX3-peroxiredoxin 3 Gene View larger

PRDX3-peroxiredoxin 3 Gene

PTXBC021691

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRDX3-peroxiredoxin 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRDX3-peroxiredoxin 3 Gene

Proteogenix catalog: PTXBC021691
Ncbi symbol: PRDX3
Product name: PRDX3-peroxiredoxin 3 Gene
Size: 2ug
Accessions: BC021691
Gene id: 10935
Gene description: peroxiredoxin 3
Synonyms: AOP-1; AOP1; HBC189; MER5; PRO1748; SP-22; prx-III; thioredoxin-dependent peroxide reductase, mitochondrial; antioxidant protein 1; peroxiredoxin III; protein MER5 homolog; peroxiredoxin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctgctgtaggacggttgctccgagcgtcggttgcccgacatgtgagtgccattccttggggcatttctgccactgcagccctcaggcctgctgcatgtggaagaacgagcttgacaaatttattgtgttctggttccagtcaagcaaaattattcagcaccagttcctcatgccatgcacctgctgtcacccagcatgcaccctattttaagggtacagccgttgtcaatggagagttcaaagacctaagccttgatgactttaaggggaaatatttggtgcttttcttctatcctttggatttcacctttgtgtgtcctacagaaattgttgcttttagtgacaaagctaacgaatttcacgatgtgaactgtgaagttgtcgcagtctcagtggattcccactttagccatcttgcctggataaatacaccaaggaagaatggtggtttgggccacatgaacatcgcactcttgtcagacttaactaagcagatttcccgagactacggtgtgctgttagaaggttctggtcttgcactaagaggtctcttcataattgaccccaatggagtcatcaagcatttgagcgtcaacgatctcccagtgggccgaagcgtggaagaaaccctccgcttggtgaaggcgttccagtatgtagaaacacatggagaagtctgcccagcgaactggacaccggattctcctacgatcaagccaagtccagctgcttccaaagagtactttcagaaggtaaatcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: