FOXS1-forkhead box S1 Gene View larger

FOXS1-forkhead box S1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FOXS1-forkhead box S1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FOXS1-forkhead box S1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013408
Product type: DNA & cDNA
Ncbi symbol: FOXS1
Origin species: Human
Product name: FOXS1-forkhead box S1 Gene
Size: 2ug
Accessions: BC013408
Gene id: 2307
Gene description: forkhead box S1
Synonyms: FKHL18; FREAC10; forkhead box protein S1; FREAC-10; forkhead-like 18 protein; forkhead-related activator 10; forkhead-related transcription factor 10; forkhead-related transcription factor FREAC-10; forkhead box S1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagcagcagcctctgcccgggcctggcgcccccacaactgagccaaccaagcctccctacagctacatcgcccttattgctatggccatccagagctcaccggggcagcgggccaccctcagtggcatctaccgctacatcatgggccgattcgccttctaccgccacaaccggcccggctggcagaacagcatccgccacaacctgtcactcaacgagtgctttgtcaaggtgccccgcgatgaccgcaagccaggcaagggcagctactggacgctggaccctgactgccacgacatgtttgagcacggcagcttcctacgccgccgccgccgcttcacccggcagacaggtgctgagggcacccggggccccgccaaggcacgccgtggacccctcagggcgaccagccaggacccaggagtccccaacgccacgaccggcaggcagtgctcattcccaccagagctgccagatcccaagggcctaagctttgggggtctggtgggggccatgccagccagtatgtgcccagcaaccactgatggcaggcctcggccacccatggagcccaaagagatttccacgcccaagcctgcatgcccaggggagctccccgtggccacctcatcttcctcatgcccagcgtttggctttcctgccggcttctcagaggctgagagttttaataaggcccctacgcccgtcttgtccccggaatcaggcatcgggagcagctaccagtgtcggctgcaggcactgaatttttgcatgggggctgacccaggccttgagcacctcttggcctcagcagccccctcccctgcaccacccacccctccaggctcactccgggccccactgcccctgccaactgaccacaaggaaccctgggttgcaggtggcttccctgtccagggaggctccggctacccattggggctgaccccctgcctataccggacgccaggaatgttcttctttgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sequestosome 1
- galactokinase 1
- synaptotagmin IV
- tubulin, beta 3

Buy FOXS1-forkhead box S1 Gene now

Add to cart