BARX1-BARX homeobox 1 Gene View larger

BARX1-BARX homeobox 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BARX1-BARX homeobox 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BARX1-BARX homeobox 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009458
Product type: DNA & cDNA
Ncbi symbol: BARX1
Origin species: Human
Product name: BARX1-BARX homeobox 1 Gene
Size: 2ug
Accessions: BC009458
Gene id: 56033
Gene description: BARX homeobox 1
Synonyms: homeobox protein BarH-like 1; BarH-like homeobox 1; BARX homeobox 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcctggagaaacgcttcgagaagcagaagtacctttccacgccggacagaatagatcttgctgagtccctgggcctgagccagttgcaggtgaagacgtggtaccagaatcggaggatgaagtggaagaaaatagtgctgcagggcggcggcctggagtctcccaccaagcccaaggggcggcccaagaagaactcaattccaacgagcgagcagcttactgagcaggagcgcgccaaggatgcagagaaaccggcggaggtgccgggcgagcccagcgacaggagccgcgaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serum amyloid A1
- stathmin-like 3
- synaptogyrin 1
- peroxiredoxin 3

Buy BARX1-BARX homeobox 1 Gene now

Add to cart