Cart 3 Product Products 340,20 € (empty)
-
1 x MYH7B-myos...113,40 € -
1 x MYCL1-v-my...113,40 € -
1 x MYF6-myoge...113,40 €
No products
To be determined Shipping
340,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 340,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 340,20 €
Data sheet of RFK-riboflavin kinase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RFK-riboflavin kinase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007069 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RFK |
| Origin species: | Human |
| Product name: | RFK-riboflavin kinase Gene |
| Size: | 2ug |
| Accessions: | BC007069 |
| Gene id: | 55312 |
| Gene description: | riboflavin kinase |
| Synonyms: | RIFK; riboflavin kinase; 0610038L10Rik; ATP:riboflavin 5'-phosphotransferase; flavokinase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccccgagcggactgcattatgaggcacctgccttacttctgccggggtcaagtggtgcggggcttcggccgcggctccaagcagctgggcatccccacagctaattttcctgagcaagtggtagataatcttccagctgatatatccactggtatttactatggttgggccagtgttggaagtggagatgtccataagatggtggtgagcataggatggaacccatattacaagaatacgaagaagtctatggaaacacatatcatgcataccttcaaagaggacttctatggggaaatcctcaatgtcgccattgttggctacctgagaccagaaaagaactttgattctttagagtcacttatttcagcaattcaaggtgatattgaagaagctaagaaacgactagagttaccagaacatttgaaaatcaaagaagacaatttcttccaggtttctaaaagcaaaataatgaatggccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - peroxiredoxin 1 - forkhead box A3 - spermine synthase - mevalonate kinase |