Login to display prices
Login to display prices
EGFL8-EGF-like-domain, multiple 8 Gene View larger

EGFL8-EGF-like-domain, multiple 8 Gene

PTXBC035574

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EGFL8-EGF-like-domain, multiple 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EGFL8-EGF-like-domain, multiple 8 Gene

Proteogenix catalog: PTXBC035574
Ncbi symbol: EGFL8
Product name: EGFL8-EGF-like-domain, multiple 8 Gene
Size: 2ug
Accessions: BC035574
Gene id: 80864
Gene description: EGF-like-domain, multiple 8
Synonyms: C6orf8; NG3; epidermal growth factor-like protein 8; EGF-like protein 8; VE-statin-2; vascular endothelial statin-2; EGF like domain multiple 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggtccagggctgagctgtgcactctcttaggcggattctccttcctcctgctactgataccaggcgagggggccaagggtggatccctcagagagagtcagggagtctgctccaagcagacactggtggtcccgctccactacaacgagtcctacagccaaccagtgtacaagccctacctgaccttgtgcgctgggaggcgcatctgcagcacttacaggaccatgtaccgcgttatgtggcgggaggtgaggcgggaggttcagcagacccatgcagtgtgctgccagggctggaagaagcggcacccgggggcgctcacctgtgaagccatctgcgccaagccttgcctgaacggaggcgtctgcgttaggcctgaccagtgcgagtgcgcccccggctggggagggaagcactgtcatgtggacgtggatgaatgtaggaccagcatcaccctctgctcgcaccattgttttaatacggcaggcagcttcacctgcggctgcccccatgacctagtgctaggcgtggacgggcgcacctgcatggaggggtccccagagcccccaaccagtgccagcatactcagcgtggccgttcgggaggcggaaaaagatgagcgcgctctgaagcaggagattcacgagctgcgagggcgcctggagcggctggagcagtgggccggtcaggctggggcctgggtcagagcggtgctgcccgtgccgcctgaagagctgcagccagaacaggtggctgagctgtggggccggggtgaccggatcgaatctctcagcgaccaggtgctgctgctgcaggagaggctaggtgcctgctcctgtgaggacaacagcctgggcctcggcgtcaatcatcgataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: