RPLP1-ribosomal protein, large, P1 Gene View larger

RPLP1-ribosomal protein, large, P1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPLP1-ribosomal protein, large, P1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPLP1-ribosomal protein, large, P1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003369
Product type: DNA & cDNA
Ncbi symbol: RPLP1
Origin species: Human
Product name: RPLP1-ribosomal protein, large, P1 Gene
Size: 2ug
Accessions: BC003369
Gene id: 6176
Gene description: ribosomal protein, large, P1
Synonyms: LP1; RPP1; 60S acidic ribosomal protein P1; acidic ribosomal phosphoprotein P1; ribosomal protein, large, P1; ribosomal protein lateral stalk subunit P1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctctgtctccgagctcgcctgcatctactcggccctcattctgcacgacgatgaggtgacagtcacggaggataagatcaatgccctcattaaagcagccggtgtaaatgttgagcctttttggcctggcttgtttgcaaaggccctggccaacgtcaacattgggagcctcatctgcaatgtaggggccggtggacctgctccagcagctggtgctgcaccagcaggaggtcctgccccctccactgctgctgctccagctgaggagaagaaagtggaagcaaagaaagaagaatccgaggagtctgatgatgacatgggctttggtctttttgactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - claudin domain containing 1
- snail homolog 1 (Drosophila)
- integral membrane protein 2B
- RNA binding motif protein 11

Buy RPLP1-ribosomal protein, large, P1 Gene now

Add to cart