RNF7-ring finger protein 7 Gene View larger

RNF7-ring finger protein 7 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF7-ring finger protein 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RNF7-ring finger protein 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008627
Product type: DNA & cDNA
Ncbi symbol: RNF7
Origin species: Human
Product name: RNF7-ring finger protein 7 Gene
Size: 2ug
Accessions: BC008627
Gene id: 9616
Gene description: ring finger protein 7
Synonyms: CKBBP1; ROC2; SAG; RING-box protein 2; CKII beta-binding protein 1; rbx2; regulator of cullins 2; sensitive to apoptosis gene protein; sensitive to apoptosis, zinc RING finger protein SAG, regulator of cullins 2; zinc RING finger protein SAG; ring finger protein 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgacgtggaagacggagaggaaacctgcgccctggcctctcactccgggagctcaggctccaagtcgggaggcgacaagatgttctccctcaagaagtggaacgcggtggccatgtggagctgggacgtggagtgcgatacgtgcgccatctgcagggtccaggtgatggatgcctgtcttagatgtcaagctgaaaacaaacaagaggactgtgttgtggtctggggagaatgtaatcattccttccacaactgctgcatgtccctgtgggtgaaacagaacaatcgctgccctctctgccagcaggactgggtggtccaaagaatcggcaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 15 kDa selenoprotein
- lysophospholipase I
- centromere protein H
- carbonic anhydrase VII

Buy RNF7-ring finger protein 7 Gene now

Add to cart