PTXBC008627
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC008627 |
Product type: | DNA & cDNA |
Ncbi symbol: | RNF7 |
Origin species: | Human |
Product name: | RNF7-ring finger protein 7 Gene |
Size: | 2ug |
Accessions: | BC008627 |
Gene id: | 9616 |
Gene description: | ring finger protein 7 |
Synonyms: | CKBBP1; ROC2; SAG; RING-box protein 2; CKII beta-binding protein 1; rbx2; regulator of cullins 2; sensitive to apoptosis gene protein; sensitive to apoptosis, zinc RING finger protein SAG, regulator of cullins 2; zinc RING finger protein SAG; ring finger protein 7 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggccgacgtggaagacggagaggaaacctgcgccctggcctctcactccgggagctcaggctccaagtcgggaggcgacaagatgttctccctcaagaagtggaacgcggtggccatgtggagctgggacgtggagtgcgatacgtgcgccatctgcagggtccaggtgatggatgcctgtcttagatgtcaagctgaaaacaaacaagaggactgtgttgtggtctggggagaatgtaatcattccttccacaactgctgcatgtccctgtgggtgaaacagaacaatcgctgccctctctgccagcaggactgggtggtccaaagaatcggcaaatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - 15 kDa selenoprotein - lysophospholipase I - centromere protein H - carbonic anhydrase VII |