No products
Prices are tax excluded
PTXBC011175
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011175 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TYROBP |
| Origin species: | Human |
| Product name: | TYROBP-TYRO protein tyrosine kinase binding protein Gene |
| Size: | 2ug |
| Accessions: | BC011175 |
| Gene id: | 7305 |
| Gene description: | TYRO protein tyrosine kinase binding protein |
| Synonyms: | KARAP; PLOSL; TYRO protein tyrosine kinase-binding protein; DNAX-activation protein 12; KAR-associated protein; killer-activating receptor-associated protein; TYRO protein tyrosine kinase binding protein |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggggacttgaaccctgcagcaggctcctgctcctgcctctcctgctggctgtaagtggtctccgtcctgtccaggcccaggcccagagcgattgcagttgctctacggtgagcccgggcgtgctggcagggatcgtgatgggagacctggtgctgacagtgctcattgccctggccgtgtacttcctgggccggctggtccctcgggggcgaggggctgcggaggcagcgacccggaaacagcgtatcactgagaccgagtcgccttatcaggagctccagggtcagaggtcggatgtctacagcgacctcaacacacagaggccgtattacaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 26, member E - dehydrogenase/reductase (SDR family) X-linked - family with sequence similarity 96, member A - tRNA selenocysteine 1 associated protein 1 |