Login to display prices
Login to display prices
FAM26E-family with sequence similarity 26, member E Gene View larger

FAM26E-family with sequence similarity 26, member E Gene

PTXBC032556

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM26E-family with sequence similarity 26, member E Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM26E-family with sequence similarity 26, member E Gene

Proteogenix catalog: PTXBC032556
Ncbi symbol: FAM26E
Product name: FAM26E-family with sequence similarity 26, member E Gene
Size: 2ug
Accessions: BC032556
Gene id: 254228
Gene description: family with sequence similarity 26, member E
Synonyms: protein FAM26E; C6orf188; dJ493F7.3; family with sequence similarity 26 member E
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgcttttcagggcattttaaaattcttccttaatcagaaaactgttattggctacagcttcatggctctgctgaccgtgggaagtgagcgtctcttttctgttgtggcttttaagtgcccctgcagcactgagaatatgacctatgggctggttttcctctttgctcctgcctgggtgttactgatcctgggattctttctgaacaataggtcgtggagactcttcacaggctgctgtgtgaatcccaggaaaatctttcccagaggccacagctgccgtttcttctacgtcctcggccagatcactctgagctcattggtggctccagtgatgtggctttctgtggctctgctcaatggaactttctatgaatgtgccatgagcgggacgagaagttcaggactcctggaactgatttgcaagggtaagcccaaagagtgctgggaagaacttcacaaagtatcttgtggcaaaactagcatgctacctaccgtcaatgaagaactgaaactctcccttcaggcccagtctcagattctaggatggtgcctgatttgttcagcgtctttcttctctctgctcaccacatgttatgctcgctgccgatctaaagttagctaccttcagctgagtttttggaagacatatgcacaaaaggagaaggagcagttggaaaatacatttctggactatgccaacaagctgagcgagaggaacctgaaatgtttttttgaaaacaagaggccagatccttttcccatgcctacgtttgctgcctgggaggctgcttcagagctgcattctttccaccaaagccagcaacactatagcaccctccacagagtggtggacaatggtctgcaacttagccctgaggatgatgagacgacaatggtccttgtgggtactgcccacaatatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: