Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of UCN2-urocortin 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UCN2-urocortin 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002647 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UCN2 |
| Origin species: | Human |
| Product name: | UCN2-urocortin 2 Gene |
| Size: | 2ug |
| Accessions: | BC002647 |
| Gene id: | 90226 |
| Gene description: | urocortin 2 |
| Synonyms: | SRP; UCN-II; UCNI; URP; urocortin-2; prepro-urocortin 2; stresscopin-related peptide; ucn II; urocortin II; urocortin-related peptide; urocortin 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccaggtgtgctctgctgttgctgatggtcctgatgttgggcagagtcctggttgtcccagtgacccctatcccaaccttccagctccgccctcagaattctccccagaccactccccgacctgcggcctcagagagcccctcagctgctcccacatggccgtgggctgcccagagccactgcagccccacccgccaccctggctcgcgcattgtcctatcgctggatgtccccatcggcctcttgcagatcttactggagcaagcccgggccagggctgccagggagcaggccaccaccaacgcccgcatcctggcccgtgtcggccactgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - secernin 3 - CD9 molecule - reticulon 3 - myozenin 2 |