UCN2-urocortin 2 Gene View larger

UCN2-urocortin 2 Gene

PTXBC002647

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UCN2-urocortin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UCN2-urocortin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002647
Product type: DNA & cDNA
Ncbi symbol: UCN2
Origin species: Human
Product name: UCN2-urocortin 2 Gene
Size: 2ug
Accessions: BC002647
Gene id: 90226
Gene description: urocortin 2
Synonyms: SRP; UCN-II; UCNI; URP; urocortin-2; prepro-urocortin 2; stresscopin-related peptide; ucn II; urocortin II; urocortin-related peptide; urocortin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccaggtgtgctctgctgttgctgatggtcctgatgttgggcagagtcctggttgtcccagtgacccctatcccaaccttccagctccgccctcagaattctccccagaccactccccgacctgcggcctcagagagcccctcagctgctcccacatggccgtgggctgcccagagccactgcagccccacccgccaccctggctcgcgcattgtcctatcgctggatgtccccatcggcctcttgcagatcttactggagcaagcccgggccagggctgccagggagcaggccaccaccaacgcccgcatcctggcccgtgtcggccactgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - secernin 3
- CD9 molecule
- reticulon 3
- myozenin 2

Buy UCN2-urocortin 2 Gene now

Add to cart