Login to display prices
Login to display prices
RTN3-reticulon 3 Gene View larger

RTN3-reticulon 3 Gene

PTXBC000634

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RTN3-reticulon 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RTN3-reticulon 3 Gene

Proteogenix catalog: PTXBC000634
Ncbi symbol: RTN3
Product name: RTN3-reticulon 3 Gene
Size: 2ug
Accessions: BC000634
Gene id: 10313
Gene description: reticulon 3
Synonyms: RTN3-A1; ASYIP; HAP; NSPL2; NSPLII; reticulon-3; ASY interacting protein; NSP-like protein 2; NSP-like protein II; homolog of ASY protein; neuroendocrine-specific protein-like 2; neuroendocrine-specific protein-like II; reticulon 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagccgtcggcggccactcagtcccattccatctcctcgtcgtccttcggagccgagccgtccgcgcccggcggcggcgggagcccaggagcctgccccgccctggggacgaagagctgcagctcctcctgtgcggtgcacgatctgattttctggagagatgtgaagaagactgggtttgtctttggcaccacgctgatcatgctgctttccctggcagctttcagtgtcatcagtgtggtttcttacctcatcctggctcttctctctgtcaccatcagcttcaggatctacaagtccgtcatccaagctgtacagaagtcagaagaaggccatccattcaaagcctacctggacgtagacattactctgtcctcagaagctttccataattacatgaatgctgccatggtgcacatcaacagggccctgaaactcattattcgtctctttctggtagaagatctggttgactccttgaagctggctgtcttcatgtggctgatgacctatgttggtgctgtttttaacggaatcacccttctaattcttgctgaactgctcattttcagtgtcccgattgtctatgagaagtacaagacccagattgatcactatgttggcatcgcccgagatcagaccaagtcaattgttgaaaagatccaagcaaaactccctggaatcgccaaaaaaaaggcagaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: