Login to display prices
Login to display prices
CD9-CD9 molecule Gene View larger

CD9-CD9 molecule Gene

PTXBC011988

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD9-CD9 molecule Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD9-CD9 molecule Gene

Proteogenix catalog: PTXBC011988
Ncbi symbol: CD9
Product name: CD9-CD9 molecule Gene
Size: 2ug
Accessions: BC011988
Gene id: 928
Gene description: CD9 molecule
Synonyms: CD9 molecule; antigen CD9; CD9 antigen (p24); CD9 antigen; BTCC-1; DRAP-27; MIC3; MRP-1; TSPAN-29; TSPAN29; 5H9 antigen; BA-2/p24 antigen; cell growth-inhibiting gene 2 protein; leukocyte antigen MIC3; motility related protein-1; tetraspanin-29
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggtcaaaggaggcaccaagtgcatcaaatacctgctgttcggatttaacttcatcttctggcttgccgggattgctgtccttgccattggactatggctccgattcgactctcagaccaagagcatcttcgagcaagaaactaataataataattccagcttctacacaggagtctatattctgatcggagccggcgccctcatgatgctggtgggcttcctgggctgctgcggggctgtgcaggagtcccagtgcatgctgggactgttcttcggcttcctcttggtgatattcgccattgaaatagctgcggccatctggggatattcccacaaggatgaggtgattaaggaagtccaggagttttacaaggacacctacaacaagctgaaaaccaaggatgagccccagcgggaaacgctgaaagccatccactatgcgttgaactgctgtggtttggctgggggcgtggaacagtttatctcagacatctgccccaagaaggacgtactcgaaaccttcaccgtgaagtcctgtcctgatgccatcaaagaggtcttcgacaataaattccacatcatcggcgcagtgggcatcggcattgccgtggtcatgatatttggcatgatcttcagtacgatcttgtgctgtgctatccgcaggaaccgcgagatggtctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: