SCRN3-secernin 3 Gene View larger

SCRN3-secernin 3 Gene

PTXBC031821

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCRN3-secernin 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCRN3-secernin 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031821
Product type: DNA & cDNA
Ncbi symbol: SCRN3
Origin species: Human
Product name: SCRN3-secernin 3 Gene
Size: 2ug
Accessions: BC031821
Gene id: 79634
Gene description: secernin 3
Synonyms: SES3; secernin-3; secernin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagaaactatgctaagcggaaaggttggtgggatggtaaaaaggagtttgattttgctgcagcatattcctatcttgacacagccaagatgatgacttcatcaggcagatactgtgagggctacaagcttctaaataagcacaaaggaaatataacttttgaaacaatgatggaaattcttcgagataaaccaagtggcattaatatggagggagaattcctgaccactgcaagcatggtttctattttacctcaagactccagccttccttgcattcacttctttacagggactcctgatcctgagagatctgtttttaagcctttcatatttgtgccacatatttcacaactattggataccagttcaccaacatttgaacttgaagatctagttaaaaagaaatcacattttaagcctgacagaagacacccactctaccaaaaacatcaacaggcattggaagtagtaaataataatgaggaaaaagccaaaataatgttggacaacatgaggaaactggagaaagaactattcagagagatggaatcaatccttcaaaacaagcatcttgatgtggagaaaattgttaatctctttcctcagtgtacaaaagatgaaattcaaatttatcagtcaaatttatcagtcaaagttagttcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD9 molecule
- reticulon 3
- myozenin 2
- myozenin 1

Buy SCRN3-secernin 3 Gene now

Add to cart