Login to display prices
Login to display prices
CFLP1-cofilin pseudogene 1 Gene View larger

CFLP1-cofilin pseudogene 1 Gene

PTXBC031631

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CFLP1-cofilin pseudogene 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CFLP1-cofilin pseudogene 1 Gene

Proteogenix catalog: PTXBC031631
Ncbi symbol: CFLP1
Product name: CFLP1-cofilin pseudogene 1 Gene
Size: 2ug
Accessions: BC031631
Gene id: 142913
Gene description: cofilin pseudogene 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctcccatgtggctgtctttgatgatgtcatcaaggtgttcagtgacatgaaagtgtgcaagtcttcaacactagaaaaggtgaagaagcgcaagaagttgctgctcttctgcctgagtgagtacaagaagtacatcatccttgcggaggccaagaagatcctggtaagtaatgtggaccaaaccattgatgatccctatgccacttttgtcaagatgctgacagtaaggactgccgctacgccccttatgacgccaccaaggacagcaagaagaaggacctggtgtttatcttctgggcctctgagtctgcatccattaagagcaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: