CFLP1-cofilin pseudogene 1 Gene View larger

CFLP1-cofilin pseudogene 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CFLP1-cofilin pseudogene 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CFLP1-cofilin pseudogene 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031631
Product type: DNA & cDNA
Ncbi symbol: CFLP1
Origin species: Human
Product name: CFLP1-cofilin pseudogene 1 Gene
Size: 2ug
Accessions: BC031631
Gene id: 142913
Gene description: cofilin pseudogene 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctcccatgtggctgtctttgatgatgtcatcaaggtgttcagtgacatgaaagtgtgcaagtcttcaacactagaaaaggtgaagaagcgcaagaagttgctgctcttctgcctgagtgagtacaagaagtacatcatccttgcggaggccaagaagatcctggtaagtaatgtggaccaaaccattgatgatccctatgccacttttgtcaagatgctgacagtaaggactgccgctacgccccttatgacgccaccaaggacagcaagaagaaggacctggtgtttatcttctgggcctctgagtctgcatccattaagagcaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ring finger protein 7
- 15 kDa selenoprotein
- lysophospholipase I
- centromere protein H

Buy CFLP1-cofilin pseudogene 1 Gene now

Add to cart