PTXBC015176
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC015176 |
Product type: | DNA & cDNA |
Ncbi symbol: | PARP6 |
Origin species: | Human |
Product name: | PARP6-poly (ADP-ribose) polymerase family, member 6 Gene |
Size: | 2ug |
Accessions: | BC015176 |
Gene id: | 56965 |
Gene description: | poly (ADP-ribose) polymerase family, member 6 |
Synonyms: | ARTD17; PARP-6-B1; PARP-6-C; pART17; poly [ADP-ribose] polymerase 6; ADP-ribosyltransferase diphtheria toxin-like 17; PARP-6; poly(ADP-ribose) polymerase family member 6 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgggaaaaggacagcacaggatgccctccaaggatgagctggtccagagatacaacaggatgaataccatcccccagacccgatccattcagtcacggttcctgcagagtcggaatctaaactgtatagcactttgtgaagtgattacatctaaggacctccagaagcatgggaacatctgggtgtgccctgtgtccgaccatgtctgcacaagattcttctttgtatatgaggatggtcaggtgggcgatgccaacattaatactcaggaccccaagatacagaaggaaatcatgcgtgtgatcggaactcaggtttacacaaactga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - TYRO protein tyrosine kinase binding protein - family with sequence similarity 26, member E - dehydrogenase/reductase (SDR family) X-linked - family with sequence similarity 96, member A |