Login to display prices
Login to display prices
BRP44L-brain protein 44-like Gene View larger

BRP44L-brain protein 44-like Gene

PTXBC000810

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BRP44L-brain protein 44-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BRP44L-brain protein 44-like Gene

Proteogenix catalog: PTXBC000810
Ncbi symbol: BRP44L
Product name: BRP44L-brain protein 44-like Gene
Size: 2ug
Accessions: BC000810
Gene id: 51660
Gene description: brain protein 44-like
Synonyms: BRP44L; CGI-129; MPYCD; dJ68L15.3; mitochondrial pyruvate carrier 1; HSPC040 protein; brain protein 44-like protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggcgcgttggtgcggaaagcggcggactatgtccgaagcaaggatttccgggactacctcatgagtacgcacttctggggcccagtagccaactggggtcttcccattgctgccatcaatgatatgaaaaagtctccagagattatcagtgggcggatgacatttgccctctgttgctattctttgacattcatgagatttgcctacaaggtacagcctcggaactggcttctgtttgcatgccacgcaacaaatgaagtagcccagctcatccagggagggcggcttatcaaacacgagatgactaaaacggcatctgcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: