MRPS33-mitochondrial ribosomal protein S33 Gene View larger

MRPS33-mitochondrial ribosomal protein S33 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS33-mitochondrial ribosomal protein S33 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS33-mitochondrial ribosomal protein S33 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015462
Product type: DNA & cDNA
Ncbi symbol: MRPS33
Origin species: Human
Product name: MRPS33-mitochondrial ribosomal protein S33 Gene
Size: 2ug
Accessions: BC015462
Gene id: 51650
Gene description: mitochondrial ribosomal protein S33
Synonyms: CGI-139; MRP-S33; PTD003; S33mt; 28S ribosomal protein S33, mitochondrial; mitochondrial ribosomal protein S33
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctccctttcagaatatgccttccgcatgtctcgtctcagtgcccggctatttggtgaagtcaccaggcctactaattccaagtctatgaaagtggtgaaactgtttagtgaactgcccttggccaagaagaaggagacttatgattggtatccaaatcaccacacttacgctgaactcatgcagacgctccgatttcttggactctacagagatgagcatcaggattttatggatgagcaaaaacgactaaagaagcttcgtggaaaggagaaaccaaagaaaggagaagggaaaagagcagcaaaaaggaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - alpha-2-glycoprotein 1, zinc-binding
- chromosome 2 open reading frame 58
- chromosome 5 open reading frame 36
- chromosome 7 open reading frame 16

Buy MRPS33-mitochondrial ribosomal protein S33 Gene now

Add to cart