Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ATPIF1-ATPase inhibitory factor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATPIF1-ATPase inhibitory factor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009677 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATPIF1 |
| Origin species: | Human |
| Product name: | ATPIF1-ATPase inhibitory factor 1 Gene |
| Size: | 2ug |
| Accessions: | BC009677 |
| Gene id: | 93974 |
| Gene description: | ATPase inhibitory factor 1 |
| Synonyms: | ATPI; ATPIP; ATPase inhibitor, mitochondrial; ATP synthase inhibitor protein; ATPase inhibitor protein; IF(1); IF1; inhibitor of F(1)F(o)-ATPase; ATPase inhibitory factor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagtgacggcgttggcggcgcggacgtggcttggcgtgtggggcgtgaggaccatgcaagcccgaggcttcggctcggatcagtccgagaatgtcgaccggggcgcgggctccatccgggaagccggtggggccttcggaaagagagagcaggctgaagaggaacgatatttccgagcacagagtagagaacaactggcagctttgaaaaaacaccatgaagaagaaatcgttcatcataagaaggagattgagcgtctgcagaaagaaattgagcgccataagcagaagatcaaaatgctaaaacatgatgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - EGF-like-domain, multiple 8 - histone cluster 1, H2am - Norrie disease (pseudoglioma) - glia maturation factor, beta |