Login to display prices
Login to display prices
ATPIF1-ATPase inhibitory factor 1 Gene View larger

ATPIF1-ATPase inhibitory factor 1 Gene

PTXBC009677

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATPIF1-ATPase inhibitory factor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATPIF1-ATPase inhibitory factor 1 Gene

Proteogenix catalog: PTXBC009677
Ncbi symbol: ATPIF1
Product name: ATPIF1-ATPase inhibitory factor 1 Gene
Size: 2ug
Accessions: BC009677
Gene id: 93974
Gene description: ATPase inhibitory factor 1
Synonyms: ATPI; ATPIP; ATPase inhibitor, mitochondrial; ATP synthase inhibitor protein; ATPase inhibitor protein; IF(1); IF1; inhibitor of F(1)F(o)-ATPase; ATPase inhibitory factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagtgacggcgttggcggcgcggacgtggcttggcgtgtggggcgtgaggaccatgcaagcccgaggcttcggctcggatcagtccgagaatgtcgaccggggcgcgggctccatccgggaagccggtggggccttcggaaagagagagcaggctgaagaggaacgatatttccgagcacagagtagagaacaactggcagctttgaaaaaacaccatgaagaagaaatcgttcatcataagaaggagattgagcgtctgcagaaagaaattgagcgccataagcagaagatcaaaatgctaaaacatgatgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: